Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00266

HP ID(1) HP00266
Gene ID(2) 6170
Gene Symbol finder RPL39
Protein Name ribosomal protein L39
RefSeq NM_001000.2
Length of RefSeq (bp) 401
Chromosome Xq22-q24
Reference DDBJ accession
UniGene Hs.300141

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe10D11 pKA1U5 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
ARe15G08 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCNTGNCTCCGCTGCTCGCCATGTCTTCTC
ARe20A01 pKA1U5 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARe27E08 pKA1U5 CCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
ARe28D04 pKA1U5 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
ARe33A05 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARe33D08 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTNGACTCCGCTGCTCGCCATGTCTTCTC
ARe37D08 pKA1U5 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
ARe39E02 pKA1U5 GTCCNTTTCTCCGCCTATCGCNGGATGCNGTNTCCCCCTTTAANGNCGCCTCGCTCCTGN
ARe42A09 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARe44A09 pKA1U5 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
ARe46C11 pKA1U5 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARe55A10 pKA1U5 GCTCTTCCTTTCTCCGCCATCGNTGGTGTGTTCTCTGACTCCGCTGCTCGCCATGATCTT
ARe55G01 pKA1U5 GCCCTCTTCCTTTCTCCGCCATCGTGGTGTGTNCTTGACTCCGCTGCTCGCCATGTCTTC
ARe56A01 pKA1U5 GCTCTTCTTCCTTTCTCCGCCATCGTGGTGTGTNCTTGACTCCGCTGCTCGCCATGTCTT
ARe60A09 pKA1U5 GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
ARe61F06 pKA1U5 CTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTCCACTCCGCTGCTCGCCATGTCTTCTCA
ARe63F10 pKA1U5 GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
ARe68F04 pKA1U5 TGCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTC
ARe71F04 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARe77H11 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCCTGNNTCCGCTGCTCGCCATGTCTTCTC
ARe79D07 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARe81E10 pKA1U5 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARe82H03 pKA1U5 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
ARe91D12 pKA1U5 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARe95H03 pKA1U5 GTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTT
ARf07A05 pKA1U5 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
ARi04A04 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
ARi07E11 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
ARi07F11 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
ARi22E10 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARi26D12 pGCAP10 GCTCTCTTCCTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARi28E10 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARi29G04 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
ARi31F08 pGCAP10 GGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAG
ARi32A11 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARi33C02 pGCAP10 GCTCTGGTAGGGATAGAGCCCCTCTGCAGCTACCGATTTGGGAAATACCTGAGGTTTTTT
ARi35B03 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARi38E06 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
ARi40E03 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
ARi44E04 pGCAP10 GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTT
ARi49F11 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
ARi61E06 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
ARi65E04 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARi66C01 pGCAP10 GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
ARiS008C15 pGCAP10 GCTTTCTCCGCCNNCNNGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
ARiS008N21 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARiS013G14 pGCAP10 GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
ARiS020A14 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARiS020K21 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARiS045D02 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
ARiS045G17 pGCAP10 GNCNTCNTCTTCCTTTCTCNNNNTCNNGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
ARiS055P13 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
ARiS088B18 pGCAP10 GCTTTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAA
ARiS088G23 pGCAP10 GCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCAC
ARiS088J22 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
ARiS088L14 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
ARiS109H22 pGCAP10 GTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACA
ARiS118A02 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARiS122A03 pGCAP10 GCCTCCTCTTCCTTTCTCCCCCATCNTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
ARiS122I14 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
ARiS161C21 pGCAP10 GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
ARiS194K21 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
ARiS194N02 pGCAP10 GGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAGCGATTCC
ARiS198C15 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
ARiS198G18 pGCAP10
ARiS198O22 pGCAP10
RBb03E12 pKA1U5 ATCCTGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBb04G04 pKA1U5 ATCCTGTGCCCTCCTCTTCCTTTCTCCGCCATCNCTGNTTGTGTTCTTGACTCCGCTGCT
RBb05F06 pKA1U5 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBb08G05 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBb09A09 pKA1U5 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBb13C11 pKA1U5 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBb15B08 pKA1U5 TGCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGCGTTCTTGACTCCGCTGCTCGCCATGT
RBb15D01 pKA1U5 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBb17G04 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBb17H11 pKA1U5 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBb18F02 pKA1U5 TCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAG
RBb18H03 pKA1U5 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBb20D07 pKA1U5 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBb20F01 pKA1U5 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBb26E10 pGCAP1 GCTCTTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBb29F07 pGCAP1 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBb30C12 pGCAP1 GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTT
RBb36G03 pGCAP1 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBb36H01 pGCAP1 TGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBb40E12 pGCAP1 TGCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBb42G11 pGCAP1 TGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBb45D04 pGCAP1 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBb48A08 pGCAP1 CGACGTGTTTTCCTCTCTGAATCTGTTATGAACACGTTGGTTGGCTGGATTCNNTANTGN
RBb50A07 pGCAP1 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCATGCTCGCCATGTCT
RBb51B07 pGCAP1 GCCCCACNGCGCTGCTCTTGCAAAAGCCATCTTTGCATTGTTCCCCATCCGCCTCCTTGC
RBb53B01 pGCAP1 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBb55A09 pGCAP1 GCTCTTCCTTTCTCCGCCATCGTGGTGATGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBb57B03 pGCAP1 GTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTT
RBb59H02 pGCAP1 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBb60F12 pGCAP1 TGGCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBb60H04 pGCAP1 TGCGCTCGTCGCCGCCCTCCATGTGGTGCGTTCTCCTGTTTTCGGCTCGCTATGTCACGT
RBb62G04 pGCAP1 GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
RBb62G05 pGCAP1 GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCNTTTNCTTGCTCGCCGC
RBb71G11 pGCAP1 GGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBd01C02 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd07A02 pGCAP10 GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTT
RBd08D08 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBd08H07 pGCAP10 GCTTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAG
RBd08H11 pGCAP10 GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
RBd09B06 pGCAP10 GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
RBd12G04 pGCAP10 TGCTTTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACA
RBd13B03 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBd14B08 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBd14E11 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd14G09 pGCAP10
RBd16A07 pGCAP10 GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
RBd16H05 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBd23B03 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd23D04 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd25G06 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd26F11 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBd27C06 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd29B03 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBd31C11 pGCAP10 TGCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGT
RBd35A06 pGCAP10 TTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAA
RBd36H03 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBd36H07 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBd41F10 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd41H02 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBd44A09 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBd46C07 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBd48F08 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBd49E08 pGCAP10 GGCCAGCTTCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTC
RBd51D11 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBd51F01 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd53F08 pGCAP10 GTCTTCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd55E11 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd56B04 pGCAP10 GAGCGCCTTCTAAGCTCGTTCTTCCGCCAGCTTCCCTCCTCTTCCTTTCTCCGCCATCGT
RBd57G12 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd58A09 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd59A02 pGCAP10 TGCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTC
RBd63D03 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBd66F10 pGCAP10 GCTCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGT
RBd68B11 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd69H12 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd71E09 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd72H02 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd74F05 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBd74F08 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd77B09 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd77E01 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBd78C07 pGCAP10 GGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAGCGATTCC
RBd82G01 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBd83C10 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd84E05 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd85C08 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd85F11 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBd91E08 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd91G03 pGCAP10 TAGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTC
RBd91G05 pGCAP10 GCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCTCCATGTCTTCTCACAAG
RBd95C08 pGCAP10 GCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAGCGATTCCTGG
RBd95F10 pGCAP10 TGCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBd98D04 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBd98F09 pGCAP10 GATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATT
RBdS013A20 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBdS013K24 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBdS013O13 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBdS014F16 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBdS015J12 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBdS022F05 pGCAP10 CGGCCGGCCGATGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCG
RBdS040H06 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBdS040L24 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBdS051A09 pGCAP10 CGGCCGGCCGATGCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGC
RBdS051C14 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBdS051E07 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBdS051I09 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBdS070A23 pGCAP10 TGCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTC
RBdS070O07 pGCAP10 TGGTGGCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCA
RBdS075H04 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBdS081A21 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBdS083D05 pGCAP10 GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
RBdS083E14 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBdS105F16 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBdS105F23 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBdS105O12 pGCAP10 GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTT
RBdS110F24 pGCAP10 TGCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBdS110I13 pGCAP10 GTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACA
RBdS110J13 pGCAP10 GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
RBdS110J20 pGCAP10 GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
RBdS110K01 pGCAP10 GGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAG
RBdS110N02 pGCAP10 GTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACA
RBdS154H10 pGCAP10 GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
RBdS156C05 pGCAP10 GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
RBdS177F23 pGCAP10 GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
RBdS187A09 pGCAP10 GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACNNNACTTT
RBdS187G19 pGCAP10 GCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAG
RBdS187H10 pGCAP10 GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl