Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156C05

Clone ID RBdS156C05
HP ID HP00266
Gene ID 6170
Gene Symbol RPL39
Protein Name ribosomal protein L39
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001000.2
Length of RefSeq (bp) 401
Chromosome Xq22-q24
Reference DDBJ accession
UniGene Hs.300141
5'-terminal sequence GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
2011.08.28