Prev. |  KEGG KO K02924 > 

RIKEN DNA Bank Human Resource - RPL39

Gene ID NCBI Gene 6170 |  KEGG hsa:6170
Gene Symbol RPL39
Protein Name ribosomal protein L39
Synonyms L39|RPL39P42|RPL39_23_1806
Ortholog resources KEGG ortholog (KEGG orthology K02924) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082317 IRAL005N05 pOTB7 BC001019 NM_001000 Full
HGY103135 IRAL057N23 pDNR-LIB BC070205 NM_001000 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044083 ARe10D11 pKA1U5 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR046152 ARe15G08 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCNTGNCTCCGCTGCTCGCCATGTCTTCTC
HKR048001 ARe20A01 pKA1U5 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR050904 ARe27E08 pKA1U5 NM_001000.2  
CCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR051276 ARe28D04 pKA1U5 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR053205 ARe33A05 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR053280 ARe33D08 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTNGACTCCGCTGCTCGCCATGTCTTCTC
HKR054880 ARe37D08 pKA1U5 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR055698 ARe39E02 pKA1U5 NM_001000.2  
GTCCNTTTCTCCGCCTATCGCNGGATGCNGTNTCCCCCTTTAANGNCGCCTCGCTCCTGN
HKR056809 ARe42A09 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR057609 ARe44A09 pKA1U5 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR058459 ARe46C11 pKA1U5 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR062010 ARe55A10 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGNTGGTGTGTTCTCTGACTCCGCTGCTCGCCATGATCTT
HKR062145 ARe55G01 pKA1U5 NM_001000.2  
GCCCTCTTCCTTTCTCCGCCATCGTGGTGTGTNCTTGACTCCGCTGCTCGCCATGTCTTC
HKR062401 ARe56A01 pKA1U5 NM_001000.2  
GCTCTTCTTCCTTTCTCCGCCATCGTGGTGTGTNCTTGACTCCGCTGCTCGCCATGTCTT
HKR064009 ARe60A09 pKA1U5 NM_001000.2  
GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
HKR064526 ARe61F06 pKA1U5 NM_001000.2  
CTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTCCACTCCGCTGCTCGCCATGTCTTCTCA
HKR065330 ARe63F10 pKA1U5 NM_001000.2  
GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
HKR067324 ARe68F04 pKA1U5 NM_001000.2  
TGCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTC
HKR068524 ARe71F04 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR070979 ARe77H11 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCCTGNNTCCGCTGCTCGCCATGTCTTCTC
HKR071679 ARe79D07 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR072506 ARe81E10 pKA1U5 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR072971 ARe82H03 pKA1U5 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR076484 ARe91D12 pKA1U5 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR078171 ARe95H03 pKA1U5 NM_001000.2  
GTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTT
HKR082805 ARf07A05 pKA1U5 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR161604 ARi04A04 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR162907 ARi07E11 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR162931 ARi07F11 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR168906 ARi22E10 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR170484 ARi26D12 pGCAP10 NM_001000.2  
GCTCTCTTCCTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR171306 ARi28E10 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR171748 ARi29G04 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR172528 ARi31F08 pGCAP10 NM_001000.2  
GGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAG
HKR172811 ARi32A11 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR173250 ARi33C02 pGCAP10 NM_001000.2  
GCTCTGGTAGGGATAGAGCCCCTCTGCAGCTACCGATTTGGGAAATACCTGAGGTTTTTT
HKR174027 ARi35B03 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR175302 ARi38E06 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR176099 ARi40E03 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR177700 ARi44E04 pGCAP10 NM_001000.2  
GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTT
HKR179731 ARi49F11 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR184502 ARi61E06 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR186100 ARi65E04 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR186449 ARi66C01 pGCAP10 NM_001000.2  
GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
HKR203263 ARiS008C15 pGCAP10 NM_001000.2  
GCTTTCTCCGCCNNCNNGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
HKR203533 ARiS008N21 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR205358 ARiS013G14 pGCAP10 NM_001000.2  
GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
HKR208014 ARiS020A14 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR208261 ARiS020K21 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR218074 ARiS045D02 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR218161 ARiS045G17 pGCAP10 NM_001000.2  
GNCNTCNTCTTCCTTTCTCNNNNTCNNGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR222373 ARiS055P13 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR235242 ARiS088B18 pGCAP10 NM_001000.2  
GCTTTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAA
HKR235367 ARiS088G23 pGCAP10 NM_001000.2  
GCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCAC
HKR235438 ARiS088J22 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR235478 ARiS088L14 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR243790 ARiS109H22 pGCAP10 NM_001000.2  
GTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACA
HKR247202 ARiS118A02 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR248803 ARiS122A03 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCCCCATCNTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR249006 ARiS122I14 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR264469 ARiS161C21 pGCAP10 NM_001000.2  
GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
HKR277861 ARiS194K21 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR277914 ARiS194N02 pGCAP10 NM_001000.2  
GGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAGCGATTCC
HKR279263 ARiS198C15 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR279362 ARiS198G18 pGCAP10 NM_001000.2  
HKR279558 ARiS198O22 pGCAP10 NM_001000.2  
HKR321308 RBb03E12 pKA1U5 NM_001000.2  
ATCCTGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR321748 RBb04G04 pKA1U5 NM_001000.2  
ATCCTGTGCCCTCCTCTTCCTTTCTCCGCCATCNCTGNTTGTGTTCTTGACTCCGCTGCT
HKR322126 RBb05F06 pKA1U5 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR323349 RBb08G05 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR323609 RBb09A09 pKA1U5 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR325259 RBb13C11 pKA1U5 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR326032 RBb15B08 pKA1U5 NM_001000.2  
TGCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGCGTTCTTGACTCCGCTGCTCGCCATGT
HKR326073 RBb15D01 pKA1U5 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR326948 RBb17G04 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR326979 RBb17H11 pKA1U5 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR327322 RBb18F02 pKA1U5 NM_001000.2  
TCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAG
HKR327371 RBb18H03 pKA1U5 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR328079 RBb20D07 pKA1U5 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR328121 RBb20F01 pKA1U5 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR330506 RBb26E10 pGCAP1 NM_001000.2  
GCTCTTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR331727 RBb29F07 pGCAP1 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR332060 RBb30C12 pGCAP1 NM_001000.2  
GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTT
HKR334547 RBb36G03 pGCAP1 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR334569 RBb36H01 pGCAP1 NM_001000.2  
TGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR336108 RBb40E12 pGCAP1 NM_001000.2  
TGCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR336955 RBb42G11 pGCAP1 NM_001000.2  
TGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR338076 RBb45D04 pGCAP1 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR339208 RBb48A08 pGCAP1 NM_001000.2  
CGACGTGTTTTCCTCTCTGAATCTGTTATGAACACGTTGGTTGGCTGGATTCNNTANTGN
HKR340007 RBb50A07 pGCAP1 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCATGCTCGCCATGTCT
HKR340431 RBb51B07 pGCAP1 NM_001000.2  
GCCCCACNGCGCTGCTCTTGCAAAAGCCATCTTTGCATTGTTCCCCATCCGCCTCCTTGC
HKR341225 RBb53B01 pGCAP1 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR342009 RBb55A09 pGCAP1 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGATGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR342827 RBb57B03 pGCAP1 NM_001000.2  
GTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTT
HKR343770 RBb59H02 pGCAP1 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR344132 RBb60F12 pGCAP1 NM_001000.2  
TGGCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR344172 RBb60H04 pGCAP1 NM_001000.2  
TGCGCTCGTCGCCGCCCTCCATGTGGTGCGTTCTCCTGTTTTCGGCTCGCTATGTCACGT
HKR344948 RBb62G04 pGCAP1 NM_001000.2  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR344949 RBb62G05 pGCAP1 NM_001000.2  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCNTTTNCTTGCTCGCCGC
HKR348555 RBb71G11 pGCAP1 NM_001000.2  
GGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR360450 RBd01C02 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR362802 RBd07A02 pGCAP10 NM_001000.2  
GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTT
HKR363280 RBd08D08 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR363375 RBd08H07 pGCAP10 NM_001000.2  
GCTTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAG
HKR363379 RBd08H11 pGCAP10 NM_001000.2  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR363630 RBd09B06 pGCAP10 NM_001000.2  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR364948 RBd12G04 pGCAP10 NM_001000.2  
TGCTTTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACA
HKR365227 RBd13B03 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR365632 RBd14B08 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR365707 RBd14E11 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR365753 RBd14G09 pGCAP10 NM_001000.2  
HKR366407 RBd16A07 pGCAP10 NM_001000.2  
GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
HKR366573 RBd16H05 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR369227 RBd23B03 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR369276 RBd23D04 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR370150 RBd25G06 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR370531 RBd26F11 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR370854 RBd27C06 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR371627 RBd29B03 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR372459 RBd31C11 pGCAP10 NM_001000.2  
TGCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGT
HKR374006 RBd35A06 pGCAP10 NM_001000.2  
TTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAA
HKR374571 RBd36H03 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR374575 RBd36H07 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR376530 RBd41F10 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR376570 RBd41H02 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR377609 RBd44A09 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR378455 RBd46C07 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR379328 RBd48F08 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR379704 RBd49E08 pGCAP10 NM_001000.2  
GGCCAGCTTCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTC
HKR380483 RBd51D11 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR380521 RBd51F01 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR381328 RBd53F08 pGCAP10 NM_001000.2  
GTCTTCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR382107 RBd55E11 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR382428 RBd56B04 pGCAP10 NM_001000.2  
GAGCGCCTTCTAAGCTCGTTCTTCCGCCAGCTTCCCTCCTCTTCCTTTCTCCGCCATCGT
HKR382956 RBd57G12 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR383209 RBd58A09 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR383602 RBd59A02 pGCAP10 NM_001000.2  
TGCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTC
HKR385275 RBd63D03 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR386530 RBd66F10 pGCAP10 NM_001000.2  
GCTCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGT
HKR387235 RBd68B11 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR387780 RBd69H12 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR388505 RBd71E09 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR388970 RBd72H02 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR389725 RBd74F05 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR389728 RBd74F08 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR390833 RBd77B09 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR390897 RBd77E01 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR391255 RBd78C07 pGCAP10 NM_001000.2  
GGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAGCGATTCC
HKR392945 RBd82G01 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR393258 RBd83C10 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR393701 RBd84E05 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR394056 RBd85C08 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR394131 RBd85F11 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR396504 RBd91E08 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR396547 RBd91G03 pGCAP10 NM_001000.2  
TAGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTC
HKR396549 RBd91G05 pGCAP10 NM_001000.2  
GCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCTCCATGTCTTCTCACAAG
HKR398056 RBd95C08 pGCAP10 NM_001000.2  
GCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAGCGATTCCTGG
HKR398130 RBd95F10 pGCAP10 NM_001000.2  
TGCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR399276 RBd98D04 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR399329 RBd98F09 pGCAP10 NM_001000.2  
GATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATT
HKR405220 RBdS013A20 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR405464 RBdS013K24 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR405549 RBdS013O13 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR405736 RBdS014F16 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR406228 RBdS015J12 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR408925 RBdS022F05 pGCAP10 NM_001000.2  
CGGCCGGCCGATGCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCG
HKR416174 RBdS040H06 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR416288 RBdS040L24 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR420409 RBdS051A09 pGCAP10 NM_001000.2  
CGGCCGGCCGATGCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGC
HKR420462 RBdS051C14 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR420503 RBdS051E07 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR420601 RBdS051I09 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR428023 RBdS070A23 pGCAP10 NM_001000.2  
TGCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTC
HKR428343 RBdS070O07 pGCAP10 NM_001000.2  
TGGTGGCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCA
HKR430172 RBdS075H04 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR432421 RBdS081A21 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR433277 RBdS083D05 pGCAP10 NM_001000.2  
GCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCT
HKR433310 RBdS083E14 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR442136 RBdS105F16 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR442143 RBdS105F23 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR442348 RBdS105O12 pGCAP10 NM_001000.2  
GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTT
HKR444144 RBdS110F24 pGCAP10 NM_001000.2  
TGCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR444205 RBdS110I13 pGCAP10 NM_001000.2  
GTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACA
HKR444229 RBdS110J13 pGCAP10 NM_001000.2  
GCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTC
HKR444236 RBdS110J20 pGCAP10 NM_001000.2  
GCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTT
HKR444241 RBdS110K01 pGCAP10 NM_001000.2  
GGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAGGATTAAG
HKR444314 RBdS110N02 pGCAP10 NM_001000.2  
GTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACA
HKR461778 RBdS154H10 pGCAP10 NM_001000.2  
GCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCT
HKR462453 RBdS156C05 pGCAP10 NM_001000.2  
GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA
HKR470943 RBdS177F23 pGCAP10 NM_001000.2  
GCCCTCCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTC
HKR474809 RBdS187A09 pGCAP10 NM_001000.2  
GCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACNNNACTTT
HKR474963 RBdS187G19 pGCAP10 NM_001000.2  
GCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAG
HKR474978 RBdS187H10 pGCAP10 NM_001000.2  
GCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl