Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00251

HP ID(1) HP00251
Gene ID(2) 6142
Gene Symbol finder RPL18A
Protein Name ribosomal protein L18a
RefSeq NM_000980.2
Length of RefSeq (bp) 618
Chromosome 19p13
Reference DDBJ accession
UniGene Hs.337766

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe10E08 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe10H07 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe11A09 pKA1U5 TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
ARe19A04 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe19C10 pKA1U5 GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
ARe22C06 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe23B10 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARe25H01 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARe29F06 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe32A08 pKA1U5 GTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
ARe32E04 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCTATGAAGGCCTCGGGCACGCTACG
ARe33G12 pKA1U5 TGCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGNTATGAAGGCCTCGGGCACGCTACG
ARe33H09 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACNCNTTGAAGGCCTCGGGCACGCTACGA
ARe35C10 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe35D01 pKA1U5 GTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
ARe40E06 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe41E06 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe44D10 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARe51B06 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARe52G10 pKA1U5 GCCTTTTGCGGGTGGNGGCTAACGCGGAGAGCACNNCNTGAAGGCCTCGGGCACGCTACG
ARe53D07 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe56H02 pKA1U5 TGGCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACNTTCATGAAGGCCTCGGGCACGCTA
ARe64H06 pKA1U5 GCCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
ARe66F04 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe67G12 pKA1U5 GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
ARe75F08 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACCCNTTGAAGGCCTCGGGCACGCTACGA
ARe76A03 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCNATGAAGGCCTCGGGCACGCTACGA
ARe77G05 pKA1U5 GACTTCCTTTTGCGGGTGGCGGCGAACGCGGACANTNNNCCATGAAGGCCTCGGGCACGC
ARe78H05 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe80B08 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe80B09 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe80D04 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe84A05 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe85F08 pKA1U5 GCTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGAG
ARe85G07 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe86D04 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARe86F03 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARe89C05 pKA1U5 GACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGTAAGGCCTCGGGCA
ARe89H02 pKA1U5 GCTTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
ARe92E09 pKA1U5 GCTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
ARe93B04 pKA1U5 GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
ARf01G04 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARf05B07 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARf06A07 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi12F12 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi15H01 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi27E04 pGCAP10 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARi32E05 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi35E05 pGCAP10 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARi36D04 pGCAP10 GCTTTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
ARi38B07 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi41C05 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi41F07 pGCAP10 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARi44A04 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi47A11 pGCAP10 GCTTTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
ARi50G03 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi50H11 pGCAP10 GCTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
ARi53E08 pGCAP10 GACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCAC
ARi53F07 pGCAP10 GACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCAC
ARi55A07 pGCAP10 TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
ARi55F02 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi59G11 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARi68E08 pGCAP10 GCCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
ARi70E06 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARiS008K23 pGCAP10 GCCTTTTGCGGGTGGCNGCGAACGCGGANAGCACGCCATGAAGGCCTCGGGCACGCTACN
ARiS008M08 pGCAP10 GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
ARiS008N06 pGCAP10 TAATGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
ARiS008P19 pGCAP10 GCCNTNTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARiS045E23 pGCAP10
ARiS055A04 pGCAP10 GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
ARiS085H08 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARiS085K11 pGCAP10 GCTTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
ARiS085N06 pGCAP10 TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
ARiS087A22 pGCAP10 TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
ARiS088D04 pGCAP10 GCTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARiS096F23 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARiS109B01 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARiS109D15 pGCAP10 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
ARiS109K04 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARiS109L17 pGCAP10 GACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCAC
ARiS150J21 pGCAP10 ACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
ARiS194B02 pGCAP10 TGGGACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGG
ARiS198G07 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
ARiS198O01 pGCAP10 TGCCTTTNGNGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
RBb03D03 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBb09A07 pKA1U5 GTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGAGA
RBb11D09 pKA1U5 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
RBb13C09 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBb17B09 pKA1U5 TGGGCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
RBb18E02 pKA1U5 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBb19G12 pKA1U5 GTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGTCATGAAGGCCTCGGGCACGCTAC
RBb25A02 pGCAP1 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBb27H09 pGCAP1 AAATGTGAAATTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCG
RBb29G03 pGCAP1 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
RBb30B09 pGCAP1 TGTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
RBb30E05 pGCAP1 TTGCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
RBb38F02 pGCAP1 GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
RBb39E07 pGCAP1 ACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
RBb41D11 pGCAP1 GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
RBb63H12 pGCAP1 TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
RBb65E11 pGCAP1 GCCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
RBd01H03 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd05G07 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd06G09 pGCAP10 GCTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
RBd08E07 pGCAP10 GCCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
RBd14E07 pGCAP10 TTGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
RBd14F06 pGCAP10 GCCTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
RBd16C10 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd17D09 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd25G11 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd26F01 pGCAP10 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
RBd32B08 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd42D06 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd42H01 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd44G11 pGCAP10 TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
RBd46F07 pGCAP10 TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
RBd55H11 pGCAP10 GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGNNGNCCTCGGGCACGCT
RBd56B02 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGNNTCGGGCACGCTACG
RBd57H11 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGNNNCGGGCACGCTACG
RBd58E04 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGANNNNNNCGGGCACGCTACG
RBd59F01 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd60H01 pGCAP10 GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
RBd63B09 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd68H10 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd79G01 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd80C02 pGCAP10 GCCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
RBd83D11 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd86D08 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd91B04 pGCAP10 TGCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
RBd97F08 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBd99D02 pGCAP10 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
RBdS013H10 pGCAP10 GCCTTTTTCCTTTTGCNGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCA
RBdS015A06 pGCAP10 GTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
RBdS015M23 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS022J06 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS022O02 pGCAP10 GCTTGCTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCAC
RBdS051P16 pGCAP10 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
RBdS070B16 pGCAP10 GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
RBdS070F12 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS070G16 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS070H17 pGCAP10 GCTTTTTTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGC
RBdS083D06 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS083E03 pGCAP10 TGTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
RBdS104F22 pGCAP10 GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
RBdS104J15 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS105I08 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS110I07 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS132H01 pGCAP10 TGCCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
RBdS132N07 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
RBdS156F01 pGCAP10 GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
RBdS177P19 pGCAP10 GCCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
RBdS187O02 pGCAP10 GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl