Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070G16

Clone ID RBdS070G16
HP ID HP00251
Gene ID 6142
Gene Symbol RPL18A
Protein Name ribosomal protein L18a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000980.2
Length of RefSeq (bp) 618
Chromosome 19p13
Reference DDBJ accession
UniGene Hs.337766
5'-terminal sequence GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
2011.08.28