Prev. |  KEGG KO K02882 > 

RIKEN DNA Bank Human Resource - RPL18A

Gene ID NCBI Gene 6142 |  KEGG hsa:6142
Gene Symbol RPL18A
Protein Name ribosomal protein L18a
Synonyms L18A
Ortholog resources KEGG ortholog (KEGG orthology K02882) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067241 IRAK168B17 pBluescriptR BC066319 NM_000980 Full
HGY084227 IRAL010J11 pOTB7 BC007512 NM_000980 Full
HGY103462 IRAL058K22 pOTB7 BC071920 NM_000980 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE088432 M01C021B08 pDONR221 IMS03-D04 BC007512 NM_000980  
HGE088480 M01C021D08 pDONR221 IMS03-D04 BC007512 NM_000980  
HGE088528 M01C021F08 pDONR221 IMS03-D04 BC007512 NM_000980  
HGE088576 M01C021H08 pDONR221 IMS03-D04 BC007512 NM_000980  
HGE088624 M01C021J08 pDONR221 IMS03-D04 BC007512 NM_000980  
HGE088672 M01C021L08 pDONR221 IMS03-D04 BC007512 NM_000980  
HGE088720 M01C021N08 pDONR221 IMS03-D04 BC007512 NM_000980  
HGE088768 M01C021P08 pDONR221 IMS03-D04 BC007512 NM_000980  
HGE098003 M01C045A03 pDONR221 MGC12-A02 BC007512 NM_000980  
HGE098051 M01C045C03 pDONR221 MGC12-A02 BC007512 NM_000980  
HGE098099 M01C045E03 pDONR221 MGC12-A02 BC007512 NM_000980  
HGE098147 M01C045G03 pDONR221 MGC12-A02 BC007512 NM_000980  
HGE098195 M01C045I03 pDONR221 MGC12-A02 BC007512 NM_000980  
HGE098243 M01C045K03 pDONR221 MGC12-A02 BC007512 NM_000980  
HGE098291 M01C045M03 pDONR221 MGC12-A02 BC007512 NM_000980  
HGE098339 M01C045O03 pDONR221 MGC12-A02 BC007512 NM_000980  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044104 ARe10E08 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR044175 ARe10H07 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR044409 ARe11A09 pKA1U5 NM_000980.2  
TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR047604 ARe19A04 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR047658 ARe19C10 pKA1U5 NM_000980.2  
GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
HKR048854 ARe22C06 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR049234 ARe23B10 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR050169 ARe25H01 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR051726 ARe29F06 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR052808 ARe32A08 pKA1U5 NM_000980.2  
GTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR052900 ARe32E04 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCTATGAAGGCCTCGGGCACGCTACG
HKR053356 ARe33G12 pKA1U5 NM_000980.2  
TGCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGNTATGAAGGCCTCGGGCACGCTACG
HKR053377 ARe33H09 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACNCNTTGAAGGCCTCGGGCACGCTACGA
HKR054058 ARe35C10 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR054073 ARe35D01 pKA1U5 NM_000980.2  
GTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR056102 ARe40E06 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR056502 ARe41E06 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR057682 ARe44D10 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR060430 ARe51B06 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR060954 ARe52G10 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGNGGCTAACGCGGAGAGCACNNCNTGAAGGCCTCGGGCACGCTACG
HKR061279 ARe53D07 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR062570 ARe56H02 pKA1U5 NM_000980.2  
TGGCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACNTTCATGAAGGCCTCGGGCACGCTA
HKR065774 ARe64H06 pKA1U5 NM_000980.2  
GCCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR066524 ARe66F04 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR066956 ARe67G12 pKA1U5 NM_000980.2  
GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR070128 ARe75F08 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACCCNTTGAAGGCCTCGGGCACGCTACGA
HKR070403 ARe76A03 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCNATGAAGGCCTCGGGCACGCTACGA
HKR070949 ARe77G05 pKA1U5 NM_000980.2  
GACTTCCTTTTGCGGGTGGCGGCGAACGCGGACANTNNNCCATGAAGGCCTCGGGCACGC
HKR071373 ARe78H05 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR072032 ARe80B08 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR072033 ARe80B09 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR072076 ARe80D04 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR073605 ARe84A05 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR074128 ARe85F08 pKA1U5 NM_000980.2  
GCTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGAG
HKR074151 ARe85G07 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR074476 ARe86D04 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR074523 ARe86F03 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR075653 ARe89C05 pKA1U5 NM_000980.2  
GACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGTAAGGCCTCGGGCA
HKR075770 ARe89H02 pKA1U5 NM_000980.2  
GCTTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR076905 ARe92E09 pKA1U5 NM_000980.2  
GCTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
HKR077228 ARe93B04 pKA1U5 NM_000980.2  
GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR080548 ARf01G04 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR082031 ARf05B07 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR082407 ARf06A07 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR164932 ARi12F12 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR166169 ARi15H01 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR170900 ARi27E04 pGCAP10 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR172901 ARi32E05 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR174101 ARi35E05 pGCAP10 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR174476 ARi36D04 pGCAP10 NM_000980.2  
GCTTTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR175231 ARi38B07 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR176453 ARi41C05 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR176527 ARi41F07 pGCAP10 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR177604 ARi44A04 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR178811 ARi47A11 pGCAP10 NM_000980.2  
GCTTTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR180147 ARi50G03 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR180179 ARi50H11 pGCAP10 NM_000980.2  
GCTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
HKR181304 ARi53E08 pGCAP10 NM_000980.2  
GACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCAC
HKR181327 ARi53F07 pGCAP10 NM_000980.2  
GACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCAC
HKR182007 ARi55A07 pGCAP10 NM_000980.2  
TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR182122 ARi55F02 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR183755 ARi59G11 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR187304 ARi68E08 pGCAP10 NM_000980.2  
GCCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR188102 ARi70E06 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR203463 ARiS008K23 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCNGCGAACGCGGANAGCACGCCATGAAGGCCTCGGGCACGCTACN
HKR203496 ARiS008M08 pGCAP10 NM_000980.2  
GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
HKR203518 ARiS008N06 pGCAP10 NM_000980.2  
TAATGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR203579 ARiS008P19 pGCAP10 NM_000980.2  
GCCNTNTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR218119 ARiS045E23 pGCAP10 NM_000980.2  
HKR222004 ARiS055A04 pGCAP10 NM_000980.2  
GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR234176 ARiS085H08 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR234251 ARiS085K11 pGCAP10 NM_000980.2  
GCTTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR234318 ARiS085N06 pGCAP10 NM_000980.2  
TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR234822 ARiS087A22 pGCAP10 NM_000980.2  
TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR235276 ARiS088D04 pGCAP10 NM_000980.2  
GCTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR238543 ARiS096F23 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR243625 ARiS109B01 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR243687 ARiS109D15 pGCAP10 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR243844 ARiS109K04 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR243881 ARiS109L17 pGCAP10 NM_000980.2  
GACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCAC
HKR260237 ARiS150J21 pGCAP10 NM_000980.2  
ACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
HKR277626 ARiS194B02 pGCAP10 NM_000980.2  
TGGGACACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGG
HKR279351 ARiS198G07 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR279537 ARiS198O01 pGCAP10 NM_000980.2  
TGCCTTTNGNGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR321275 RBb03D03 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR323607 RBb09A07 pKA1U5 NM_000980.2  
GTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGAGA
HKR324481 RBb11D09 pKA1U5 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR325257 RBb13C09 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR326833 RBb17B09 pKA1U5 NM_000980.2  
TGGGCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
HKR327298 RBb18E02 pKA1U5 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR327756 RBb19G12 pKA1U5 NM_000980.2  
GTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGTCATGAAGGCCTCGGGCACGCTAC
HKR330002 RBb25A02 pGCAP1 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR330977 RBb27H09 pGCAP1 NM_000980.2  
AAATGTGAAATTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCG
HKR331747 RBb29G03 pGCAP1 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR332033 RBb30B09 pGCAP1 NM_000980.2  
TGTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
HKR332101 RBb30E05 pGCAP1 NM_000980.2  
TTGCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR335322 RBb38F02 pGCAP1 NM_000980.2  
GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
HKR335703 RBb39E07 pGCAP1 NM_000980.2  
ACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
HKR336483 RBb41D11 pGCAP1 NM_000980.2  
GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCT
HKR345380 RBb63H12 pGCAP1 NM_000980.2  
TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR346107 RBb65E11 pGCAP1 NM_000980.2  
GCCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR360571 RBd01H03 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR362151 RBd05G07 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR362553 RBd06G09 pGCAP10 NM_000980.2  
GCTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
HKR363303 RBd08E07 pGCAP10 NM_000980.2  
GCCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR365703 RBd14E07 pGCAP10 NM_000980.2  
TTGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
HKR365726 RBd14F06 pGCAP10 NM_000980.2  
GCCTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR366458 RBd16C10 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR366881 RBd17D09 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR370155 RBd25G11 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR370521 RBd26F01 pGCAP10 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR372832 RBd32B08 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR376878 RBd42D06 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR376969 RBd42H01 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR377755 RBd44G11 pGCAP10 NM_000980.2  
TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR378527 RBd46F07 pGCAP10 NM_000980.2  
TGCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR382179 RBd55H11 pGCAP10 NM_000980.2  
GCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGNNGNCCTCGGGCACGCT
HKR382426 RBd56B02 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGNNTCGGGCACGCTACG
HKR382979 RBd57H11 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGNNNCGGGCACGCTACG
HKR383300 RBd58E04 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGANNNNNNCGGGCACGCTACG
HKR383721 RBd59F01 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR384169 RBd60H01 pGCAP10 NM_000980.2  
GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR385233 RBd63B09 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR387378 RBd68H10 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR391745 RBd79G01 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR392050 RBd80C02 pGCAP10 NM_000980.2  
GCCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR393283 RBd83D11 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR394480 RBd86D08 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR396428 RBd91B04 pGCAP10 NM_000980.2  
TGCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR398928 RBd97F08 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR399674 RBd99D02 pGCAP10 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR405378 RBdS013H10 pGCAP10 NM_000980.2  
GCCTTTTTCCTTTTGCNGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCA
HKR406006 RBdS015A06 pGCAP10 NM_000980.2  
GTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTAC
HKR406311 RBdS015M23 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR409022 RBdS022J06 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR409138 RBdS022O02 pGCAP10 NM_000980.2  
GCTTGCTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCAC
HKR420776 RBdS051P16 pGCAP10 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR428040 RBdS070B16 pGCAP10 NM_000980.2  
GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR428132 RBdS070F12 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR428160 RBdS070G16 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR428185 RBdS070H17 pGCAP10 NM_000980.2  
GCTTTTTTTTTTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGC
HKR433278 RBdS083D06 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR433299 RBdS083E03 pGCAP10 NM_000980.2  
TGTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTA
HKR441742 RBdS104F22 pGCAP10 NM_000980.2  
GACTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGC
HKR441831 RBdS104J15 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR442200 RBdS105I08 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR444199 RBdS110I07 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR452969 RBdS132H01 pGCAP10 NM_000980.2  
TGCCTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR453119 RBdS132N07 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG
HKR462521 RBdS156F01 pGCAP10 NM_000980.2  
GCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACGA
HKR471179 RBdS177P19 pGCAP10 NM_000980.2  
GCCTTTCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACG
HKR475138 RBdS187O02 pGCAP10 NM_000980.2  
GCCTTTTGCGGGTGGCGGCGAACGCGGAGAGCACGCCATGAAGGCCTCGGGCACGCTACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl