Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00214

HP ID(1) HP00214
Gene ID(2) 6223
Gene Symbol finder RPS19
Protein Name ribosomal protein S19
RefSeq NM_001022.3
Length of RefSeq (bp) 872
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.438429

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01B11 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe03H08 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe13E01 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe17G08 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCCCNTTGCCTGGAGTTACTGTAAAAGAC
ARe18B03 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe18G10 pKA1U5 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
ARe19A05 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe21H02 pKA1U5 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
ARe25C08 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe30B01 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe39C02 pKA1U5 GACGCCCGACTTGTGCGCCCGGGAAACCCCGNTCGTTCCCTTTCCCCTGGCTGGCAGCGC
ARe42A04 pKA1U5 CCTACGCCCGACTTGTGCGCCCGGGAAACCCCGCTCGTTCCCTTTCCCCTGGCTGGCAGC
ARe46H08 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe54B01 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe54C03 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCNCGATGCCTGGAGTTACTGATAAAAGA
ARe57A12 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARe70C10 pKA1U5 GCTTTCCCCTGGCTGGCAGCGNGGAGGCCGCACNCNTTNCANGGAGGTTACTGTAAAAGA
ARe76D12 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACNTATGCCTGGAGTTACTGTAAAAGA
ARe83F11 pKA1U5 ATCCTGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAA
ARe85E04 pKA1U5 CCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
ARe96F07 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARf01E10 pKA1U5 GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTTAAAAGACG
ARi07C08 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi10E01 pGCAP10 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
ARi17C02 pGCAP10 GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
ARi19C09 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi20C02 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi23A06 pGCAP10 CGGCCGGCCGATGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTT
ARi33B11 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi47E03 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi55F07 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi60F08 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi63E02 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi64A02 pGCAP10
ARi65H04 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi67H07 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARi68B08 pGCAP10 CGGCCGGCCGATGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAG
ARiS008N14 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS013D12 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS020D18 pGCAP10 ACGCCCGACTTGTGCGCCCGGGAAACCCCGTCGTTCCCTTTCCCCTGGCTGGCAGCGCGG
ARiS023I16 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS023N10 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS049C13 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS049H14 pGCAP10 GCCCTTTCCCCTGGCTGGCANCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS055D16 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS055H08 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS085E03 pGCAP10 GCCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
ARiS085E16 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS088A16 pGCAP10 GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
ARiS096J03 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS109D01 pGCAP10 GAAGCGGGGGCTCCGAGCTGGACCGGGCGCGAGGCGGCAGGGCCGGACGCCGAAGCCTCA
ARiS109L20 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS150F16 pGCAP10 CGGCCGGCCGATGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTT
ARiS150H17 pGCAP10 GCCCTTTTTTTTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGT
ARiS191B05 pGCAP10 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
ARiS194H01 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS194M15 pGCAP10 GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
ARiS194N17 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
ARiS198J10 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBb03B10 pKA1U5
RBb04D06 pKA1U5 ATCCTGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAA
RBb08C07 pKA1U5 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBb10G01 pKA1U5 GCCTTTCCCCTGGCTGGCAGCGCGGNAGGCCGCNCTNTGCCTGGAGTTACTGTAAAAGAC
RBb13A04 pKA1U5 GCTAGAGCCGCGGCCACGNTGCGAGCGGCAGGCCCGGTACATGCCCGGTCAGCGCCGATC
RBb35A12 pGCAP1 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
RBb38A07 pGCAP1 TTTTGCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAA
RBb41F12 pGCAP1 GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
RBb45G09 pGCAP1 AAAAAAAGATTTCTCGCGAGACCCTACGCCCGACTTGTGCGCCCGGGAAACCCCGTCGTT
RBb46E01 pGCAP1
RBb65D09 pGCAP1 TGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
RBd01E05 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBd09D09 pGCAP10 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
RBd10G08 pGCAP10 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
RBd17D02 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBd19A12 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBd23D06 pGCAP10 AGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
RBd36E06 pGCAP10 TGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
RBd40B04 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBd49D03 pGCAP10 AGCTTTTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAG
RBd51A10 pGCAP10 GCCTTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBd64E09 pGCAP10 GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
RBd65G01 pGCAP10 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
RBd81E08 pGCAP10 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
RBdS007I17 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBdS015A23 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBdS015N01 pGCAP10 GCCTTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBdS015N20 pGCAP10 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
RBdS022K09 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBdS022L08 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBdS040G03 pGCAP10 GGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
RBdS081L17 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBdS083C15 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
RBdS110O07 pGCAP10 GACTCTCGCGAGACCCTACGCCCGACTTGTGCGCCCGGGAAACCCCGTCGTTCCCTTTCC
RBdS132G23 pGCAP10 GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
RBdS132J20 pGCAP10 GGTCGTTCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTA
RBdS187B21 pGCAP10 GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl