Prev. |  KEGG KO K02966 > 

RIKEN DNA Bank Human Resource - RPS19

Gene ID NCBI Gene 6223 |  KEGG hsa:6223
Gene Symbol RPS19
Protein Name ribosomal protein S19
Synonyms DBA|DBA1|S19
Ortholog resources KEGG ortholog (KEGG orthology K02966) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082851 IRAL007C03 pOTB7 BC000023 NM_001022 Full
HGY089174 IRAL022P14 pOTB7 BC007615 NM_001022 Full
HGY092419 IRAL031A19 pDNR-LIB BC017386 NM_001022 Full/var
HGY096219 IRAL040J03 pOTB7 BC018616 NM_001022 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040435 ARe01B11 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR041376 ARe03H08 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR045297 ARe13E01 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR046952 ARe17G08 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCCCNTTGCCTGGAGTTACTGTAAAAGAC
HKR047227 ARe18B03 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR047354 ARe18G10 pKA1U5 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR047605 ARe19A05 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR048570 ARe21H02 pKA1U5 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR050056 ARe25C08 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR052025 ARe30B01 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR055650 ARe39C02 pKA1U5 NM_001022.3  
GACGCCCGACTTGTGCGCCCGGGAAACCCCGNTCGTTCCCTTTCCCCTGGCTGGCAGCGC
HKR056804 ARe42A04 pKA1U5 NM_001022.3  
CCTACGCCCGACTTGTGCGCCCGGGAAACCCCGCTCGTTCCCTTTCCCCTGGCTGGCAGC
HKR058576 ARe46H08 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR061625 ARe54B01 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR061651 ARe54C03 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCNCGATGCCTGGAGTTACTGATAAAAGA
HKR062812 ARe57A12 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR068058 ARe70C10 pKA1U5 NM_001022.3  
GCTTTCCCCTGGCTGGCAGCGNGGAGGCCGCACNCNTTNCANGGAGGTTACTGTAAAAGA
HKR070484 ARe76D12 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACNTATGCCTGGAGTTACTGTAAAAGA
HKR073331 ARe83F11 pKA1U5 NM_001022.3  
ATCCTGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAA
HKR074100 ARe85E04 pKA1U5 NM_001022.3  
CCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR078527 ARe96F07 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR080506 ARf01E10 pKA1U5 NM_001022.3  
GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTTAAAAGACG
HKR162856 ARi07C08 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR164097 ARi10E01 pGCAP10 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR166850 ARi17C02 pGCAP10 NM_001022.3  
GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
HKR167657 ARi19C09 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR168050 ARi20C02 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR169206 ARi23A06 pGCAP10 NM_001022.3  
CGGCCGGCCGATGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTT
HKR173235 ARi33B11 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR178899 ARi47E03 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR182127 ARi55F07 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR184128 ARi60F08 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR185298 ARi63E02 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR185602 ARi64A02 pGCAP10 NM_001022.3  
HKR186172 ARi65H04 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR186975 ARi67H07 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR187232 ARi68B08 pGCAP10 NM_001022.3  
CGGCCGGCCGATGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAG
HKR203526 ARiS008N14 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR205284 ARiS013D12 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR208090 ARiS020D18 pGCAP10 NM_001022.3  
ACGCCCGACTTGTGCGCCCGGGAAACCCCGTCGTTCCCTTTCCCCTGGCTGGCAGCGCGG
HKR209408 ARiS023I16 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR209522 ARiS023N10 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR219661 ARiS049C13 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR219782 ARiS049H14 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCANCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR222088 ARiS055D16 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR222176 ARiS055H08 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR234099 ARiS085E03 pGCAP10 NM_001022.3  
GCCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
HKR234112 ARiS085E16 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR235216 ARiS088A16 pGCAP10 NM_001022.3  
GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
HKR238619 ARiS096J03 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR243673 ARiS109D01 pGCAP10 NM_001022.3  
GAAGCGGGGGCTCCGAGCTGGACCGGGCGCGAGGCGGCAGGGCCGGACGCCGAAGCCTCA
HKR243884 ARiS109L20 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR260136 ARiS150F16 pGCAP10 NM_001022.3  
CGGCCGGCCGATGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTT
HKR260185 ARiS150H17 pGCAP10 NM_001022.3  
GCCCTTTTTTTTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGT
HKR276429 ARiS191B05 pGCAP10 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR277769 ARiS194H01 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR277903 ARiS194M15 pGCAP10 NM_001022.3  
GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
HKR277929 ARiS194N17 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR279426 ARiS198J10 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR321234 RBb03B10 pKA1U5 NM_001022.3  
HKR321678 RBb04D06 pKA1U5 NM_001022.3  
ATCCTGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAA
HKR323255 RBb08C07 pKA1U5 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR324145 RBb10G01 pKA1U5 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGNAGGCCGCNCTNTGCCTGGAGTTACTGTAAAAGAC
HKR325204 RBb13A04 pKA1U5 NM_001022.3  
GCTAGAGCCGCGGCCACGNTGCGAGCGGCAGGCCCGGTACATGCCCGGTCAGCGCCGATC
HKR334012 RBb35A12 pGCAP1 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR335207 RBb38A07 pGCAP1 NM_001022.3  
TTTTGCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAA
HKR336532 RBb41F12 pGCAP1 NM_001022.3  
GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
HKR338153 RBb45G09 pGCAP1 NM_001022.3  
AAAAAAAGATTTCTCGCGAGACCCTACGCCCGACTTGTGCGCCCGGGAAACCCCGTCGTT
HKR338497 RBb46E01 pGCAP1 NM_001022.3  
HKR346081 RBb65D09 pGCAP1 NM_001022.3  
TGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
HKR360501 RBd01E05 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR363681 RBd09D09 pGCAP10 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR364152 RBd10G08 pGCAP10 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR366874 RBd17D02 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR367612 RBd19A12 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR369278 RBd23D06 pGCAP10 NM_001022.3  
AGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
HKR374502 RBd36E06 pGCAP10 NM_001022.3  
TGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
HKR376028 RBd40B04 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR379675 RBd49D03 pGCAP10 NM_001022.3  
AGCTTTTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAG
HKR380410 RBd51A10 pGCAP10 NM_001022.3  
GCCTTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR385705 RBd64E09 pGCAP10 NM_001022.3  
GCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACGT
HKR386145 RBd65G01 pGCAP10 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR392504 RBd81E08 pGCAP10 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR403009 RBdS007I17 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR406023 RBdS015A23 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR406313 RBdS015N01 pGCAP10 NM_001022.3  
GCCTTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR406332 RBdS015N20 pGCAP10 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR409049 RBdS022K09 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR409072 RBdS022L08 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR416147 RBdS040G03 pGCAP10 NM_001022.3  
GGCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGA
HKR432681 RBdS081L17 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR433263 RBdS083C15 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
HKR444343 RBdS110O07 pGCAP10 NM_001022.3  
GACTCTCGCGAGACCCTACGCCCGACTTGTGCGCCCGGGAAACCCCGTCGTTCCCTTTCC
HKR452967 RBdS132G23 pGCAP10 NM_001022.3  
GCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGACG
HKR453036 RBdS132J20 pGCAP10 NM_001022.3  
GGTCGTTCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTA
HKR474845 RBdS187B21 pGCAP10 NM_001022.3  
GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl