Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015A23

Clone ID RBdS015A23
HP ID HP00214
Gene ID 6223
Gene Symbol RPS19
Protein Name ribosomal protein S19
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001022.3
Length of RefSeq (bp) 872
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.438429
5'-terminal sequence GCCCTTTCCCCTGGCTGGCAGCGCGGAGGCCGCACGATGCCTGGAGTTACTGTAAAAGAC
2011.08.28