Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00200

HP ID(1) HP00200
Gene ID(2) 6160
Gene Symbol finder RPL31
Protein Name ribosomal protein L31
RefSeq NM_000993.4
Length of RefSeq (bp) 524
Chromosome 2q12.1
Reference DDBJ accession
UniGene Hs.469473

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08C12 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARe09D09 pKA1U5 TGCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARe09E07 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARe10H09 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCNCTTNGAAGGGTGGCGAGAAGAAAAAGG
ARe11A10 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARe13H04 pKA1U5 ATCCTGATTGCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGG
ARe15A05 pKA1U5 GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARe16H08 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARe21F11 pKA1U5 GCTCTTCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGA
ARe24D01 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARe25G11 pKA1U5 GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCTAAGAAGGGTGGCGAGAAGAAAAAG
ARe29E03 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARe35A06 pKA1U5 GCTTCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAA
ARe37G11 pKA1U5 GCTTTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAG
ARe40A12 pKA1U5 GCCTTCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
ARe47F11 pKA1U5 NTCCTGNCTTTTCCAACTTGTTNCNCTGCAGAANNGCTCCCGCANANNANGGTGGNNAGA
ARe47H11 pKA1U5 ATCCTGGCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAA
ARe48D10 pKA1U5 GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARe72C06 pKA1U5 GCTTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARe75H12 pKA1U5 ATCCTGGCTTTCCAACTTGGACGCTGCAGAATGCCTTCCCGCAAAGAAGGGTGGCGAGAA
ARe76G11 pKA1U5 GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGTTAAGAAGGGTGGCGAGAAGAAAAAG
ARe83H11 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARe86E05 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARe87G03 pKA1U5 GCTTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARe89F05 pKA1U5 GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARe90E06 pKA1U5 GCTTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARe91D01 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
ARi07A10 pGCAP10 GCTTTTNNNNNGNNNCTGNNAGGNNCCCNNAAAAAGGGGGGNAAAANAAAAAAGGGCCGT
ARi07C07 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARi08F06 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARi10A09 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARi12B03 pGCAP10 GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARi16F05 pGCAP10 GCCTTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAG
ARi17D05 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARi22F06 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARi26F11 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARi30B11 pGCAP10 GCTTTTCCNGCTTGCACGCTGCAGANTGGCTCCCGCAAAGAAGGGTGGCNAGAAGAAAAA
ARi33F10 pGCAP10 TTTTGCTTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAG
ARi35E07 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARi36B10 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARi38G07 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARi38H01 pGCAP10 TCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARi45B10 pGCAP10 CGGCCGGCCGATGGCGCTCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAA
ARi51A11 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARi57G06 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARi62F10 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARi69E11 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARiS008I05 pGCAP10 GCTTTCCAACTTGGNCGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARiS013G24 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARiS013H09 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARiS020A15 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARiS023O05 pGCAP10 GCTTTCCNNCTTGGACGCTGCATAATGGCTCCCGCAAAGAAGGGTGGCGAGAAAAAAAAG
ARiS045D15 pGCAP10 TGCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGA
ARiS055H14 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARiS088M02 pGCAP10 CGGCCGGCCGATGCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGC
ARiS088P01 pGCAP10 GCTTTTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
ARiS096O01 pGCAP10
ARiS118H12 pGCAP10 TTTTTTTTTTTTTTTTTTTTCCAACTTGGACGCTGCAAAATGGCTCCCGCAAAGAAGGGT
ARiS122L12 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARiS161E07 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARiS191I15 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
ARiS198A01 pGCAP10
ARiS198D09 pGCAP10 GCTTTCCAACTNGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARiS198K06 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
ARiS198K19 pGCAP10
RBb05G08 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
RBb06G12 pKA1U5 GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBb13E07 pKA1U5 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
RBb14G08 pKA1U5 GCTTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBb23E03 pGCAP1 CCTTNCCACTAGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
RBb27G08 pGCAP1 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
RBb28F01 pGCAP1 TGGCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBb29D07 pGCAP1 GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
RBb31B07 pGCAP1 GTTCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAA
RBb38A05 pGCAP1 TTGCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBb53G11 pGCAP1 TGCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBb64B01 pGCAP1 TCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBd05E03 pGCAP10 TGCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAA
RBd10E05 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBd11F09 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBd11G12 pGCAP10 GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
RBd14A10 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBd14G12 pGCAP10
RBd14H12 pGCAP10
RBd17C06 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBd17D07 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBd23A11 pGCAP10 GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
RBd34E11 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBd38D03 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBd43F09 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBd45E11 pGCAP10 GTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGGG
RBd66A09 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBd68G03 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBd83F06 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBd83H04 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBd96C02 pGCAP10 GCTTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAA
RBd96D09 pGCAP10 GCTTTTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
RBdS007K14 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBdS014G08 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBdS015P20 pGCAP10 GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
RBdS022H12 pGCAP10 TGGCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAG
RBdS022I16 pGCAP10 GCCTTTCCNACTTGGACGCTGCAAAATGGCCCCCCCAANNAACGGTGGCGAGAACAAAAA
RBdS040C04 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBdS040D02 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBdS040D15 pGCAP10 GTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGGGC
RBdS083M23 pGCAP10 GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
RBdS110H16 pGCAP10 GGGCTTTCCTTCTCCCACAATCCTTCGCGCTCTTCCTTTCCAACTTGGACGCTGCAGAAT
RBdS110L06 pGCAP10 GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
RBdS132F03 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBdS154G13 pGCAP10 GGGCTTTCCTTCTCCCACAATCCTTCGCGCTCTTCCTTTCCAACTTGGACGCTGCAGAAT
RBdS156K17 pGCAP10 GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
RBdS177O12 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBdS187K19 pGCAP10 GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
RBdS177D14 pGCAP10 GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl