Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022H12

Clone ID RBdS022H12
HP ID HP00200
Gene ID 6160
Gene Symbol RPL31
Protein Name ribosomal protein L31
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000993.4
Length of RefSeq (bp) 524
Chromosome 2q12.1
Reference DDBJ accession
UniGene Hs.469473
5'-terminal sequence TGGCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAG
2011.08.28