Prev. |  KEGG KO K02910 > 

RIKEN DNA Bank Human Resource - RPL31

Gene ID NCBI Gene 6160 |  KEGG hsa:6160
Gene Symbol RPL31
Protein Name ribosomal protein L31
Synonyms L31
Ortholog resources KEGG ortholog (KEGG orthology K02910) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081085 IRAL002L21 pOTB7 BC001663 NM_000993 Partial/var
HGY095829 IRAL039J13 pOTB7 BC017343 NM_000993 Full
HGY102908 IRAL057E12 pDNR-LIB BC070373 NM_000993 Full
HGY102928 IRAL057F08 pDNR-LIB BC070210 NM_000993 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043260 ARe08C12 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR043681 ARe09D09 pKA1U5 NM_000993.4  
TGCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR043703 ARe09E07 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR044177 ARe10H09 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCNCTTNGAAGGGTGGCGAGAAGAAAAAGG
HKR044410 ARe11A10 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR045372 ARe13H04 pKA1U5 NM_000993.4  
ATCCTGATTGCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGG
HKR046005 ARe15A05 pKA1U5 NM_000993.4  
GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR046576 ARe16H08 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR048531 ARe21F11 pKA1U5 NM_000993.4  
GCTCTTCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGA
HKR049673 ARe24D01 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR050155 ARe25G11 pKA1U5 NM_000993.4  
GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCTAAGAAGGGTGGCGAGAAGAAAAAG
HKR051699 ARe29E03 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR054006 ARe35A06 pKA1U5 NM_000993.4  
GCTTCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAA
HKR054955 ARe37G11 pKA1U5 NM_000993.4  
GCTTTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAG
HKR056012 ARe40A12 pKA1U5 NM_000993.4  
GCCTTCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
HKR058931 ARe47F11 pKA1U5 NM_000993.4  
NTCCTGNCTTTTCCAACTTGTTNCNCTGCAGAANNGCTCCCGCANANNANGGTGGNNAGA
HKR058979 ARe47H11 pKA1U5 NM_000993.4  
ATCCTGGCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAA
HKR059282 ARe48D10 pKA1U5 NM_000993.4  
GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR068854 ARe72C06 pKA1U5 NM_000993.4  
GCTTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR070180 ARe75H12 pKA1U5 NM_000993.4  
ATCCTGGCTTTCCAACTTGGACGCTGCAGAATGCCTTCCCGCAAAGAAGGGTGGCGAGAA
HKR070555 ARe76G11 pKA1U5 NM_000993.4  
GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGTTAAGAAGGGTGGCGAGAAGAAAAAG
HKR073379 ARe83H11 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR074501 ARe86E05 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR074947 ARe87G03 pKA1U5 NM_000993.4  
GCTTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR075725 ARe89F05 pKA1U5 NM_000993.4  
GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR076102 ARe90E06 pKA1U5 NM_000993.4  
GCTTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR076473 ARe91D01 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR162810 ARi07A10 pGCAP10 NM_000993.4  
GCTTTTNNNNNGNNNCTGNNAGGNNCCCNNAAAAAGGGGGGNAAAANAAAAAAGGGCCGT
HKR162855 ARi07C07 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR163326 ARi08F06 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR164009 ARi10A09 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR164827 ARi12B03 pGCAP10 NM_000993.4  
GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR166525 ARi16F05 pGCAP10 NM_000993.4  
GCCTTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAG
HKR166877 ARi17D05 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR168926 ARi22F06 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR170531 ARi26F11 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR172035 ARi30B11 pGCAP10 NM_000993.4  
GCTTTTCCNGCTTGCACGCTGCAGANTGGCTCCCGCAAAGAAGGGTGGCNAGAAGAAAAA
HKR173330 ARi33F10 pGCAP10 NM_000993.4  
TTTTGCTTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAG
HKR174103 ARi35E07 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR174434 ARi36B10 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR175351 ARi38G07 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR175369 ARi38H01 pGCAP10 NM_000993.4  
TCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR178034 ARi45B10 pGCAP10 NM_000993.4  
CGGCCGGCCGATGGCGCTCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAA
HKR180411 ARi51A11 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR182950 ARi57G06 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR184930 ARi62F10 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR187707 ARi69E11 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR203397 ARiS008I05 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGNCGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR205368 ARiS013G24 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR205377 ARiS013H09 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR208015 ARiS020A15 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR209541 ARiS023O05 pGCAP10 NM_000993.4  
GCTTTCCNNCTTGGACGCTGCATAATGGCTCCCGCAAAGAAGGGTGGCGAGAAAAAAAAG
HKR218087 ARiS045D15 pGCAP10 NM_000993.4  
TGCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGA
HKR222182 ARiS055H14 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR235490 ARiS088M02 pGCAP10 NM_000993.4  
CGGCCGGCCGATGCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGC
HKR235561 ARiS088P01 pGCAP10 NM_000993.4  
GCTTTTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
HKR238737 ARiS096O01 pGCAP10 NM_000993.4  
HKR247380 ARiS118H12 pGCAP10 NM_000993.4  
TTTTTTTTTTTTTTTTTTTTCCAACTTGGACGCTGCAAAATGGCTCCCGCAAAGAAGGGT
HKR249076 ARiS122L12 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR264503 ARiS161E07 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR276607 ARiS191I15 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR279201 ARiS198A01 pGCAP10 NM_000993.4  
HKR279281 ARiS198D09 pGCAP10 NM_000993.4  
GCTTTCCAACTNGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR279446 ARiS198K06 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR279459 ARiS198K19 pGCAP10 NM_000993.4  
HKR322152 RBb05G08 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR322556 RBb06G12 pKA1U5 NM_000993.4  
GCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR325303 RBb13E07 pKA1U5 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR325752 RBb14G08 pKA1U5 NM_000993.4  
GCTTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR329299 RBb23E03 pGCAP1 NM_000993.4  
CCTTNCCACTAGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR330952 RBb27G08 pGCAP1 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR331321 RBb28F01 pGCAP1 NM_000993.4  
TGGCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR331679 RBb29D07 pGCAP1 NM_000993.4  
GCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGG
HKR332431 RBb31B07 pGCAP1 NM_000993.4  
GTTCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAA
HKR335205 RBb38A05 pGCAP1 NM_000993.4  
TTGCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR341355 RBb53G11 pGCAP1 NM_000993.4  
TGCCTTTCCACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR345625 RBb64B01 pGCAP1 NM_000993.4  
TCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR362099 RBd05E03 pGCAP10 NM_000993.4  
TGCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAA
HKR364101 RBd10E05 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR364529 RBd11F09 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR364556 RBd11G12 pGCAP10 NM_000993.4  
GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
HKR365610 RBd14A10 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR365756 RBd14G12 pGCAP10 NM_000993.4  
HKR365780 RBd14H12 pGCAP10 NM_000993.4  
HKR366854 RBd17C06 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR366879 RBd17D07 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR369211 RBd23A11 pGCAP10 NM_000993.4  
GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
HKR373707 RBd34E11 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR375275 RBd38D03 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR377329 RBd43F09 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR378107 RBd45E11 pGCAP10 NM_000993.4  
GTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGGG
HKR386409 RBd66A09 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR387347 RBd68G03 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR393326 RBd83F06 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR393372 RBd83H04 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR398450 RBd96C02 pGCAP10 NM_000993.4  
GCTTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAA
HKR398481 RBd96D09 pGCAP10 NM_000993.4  
GCTTTTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
HKR403054 RBdS007K14 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR405752 RBdS014G08 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR406380 RBdS015P20 pGCAP10 NM_000993.4  
GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
HKR408980 RBdS022H12 pGCAP10 NM_000993.4  
TGGCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAG
HKR409008 RBdS022I16 pGCAP10 NM_000993.4  
GCCTTTCCNACTTGGACGCTGCAAAATGGCCCCCCCAANNAACGGTGGCGAGAACAAAAA
HKR416052 RBdS040C04 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR416074 RBdS040D02 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR416087 RBdS040D15 pGCAP10 NM_000993.4  
GTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAGGGC
HKR433511 RBdS083M23 pGCAP10 NM_000993.4  
GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
HKR444184 RBdS110H16 pGCAP10 NM_000993.4  
GGGCTTTCCTTCTCCCACAATCCTTCGCGCTCTTCCTTTCCAACTTGGACGCTGCAGAAT
HKR444270 RBdS110L06 pGCAP10 NM_000993.4  
GCTTCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAA
HKR452923 RBdS132F03 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR461757 RBdS154G13 pGCAP10 NM_000993.4  
GGGCTTTCCTTCTCCCACAATCCTTCGCGCTCTTCCTTTCCAACTTGGACGCTGCAGAAT
HKR462657 RBdS156K17 pGCAP10 NM_000993.4  
GCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAAG
HKR470886 RBdS177D14 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR471148 RBdS177O12 pGCAP10 NM_000993.4  
GCCTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA
HKR475059 RBdS187K19 pGCAP10 NM_000993.4  
GCTTTTCCAACTTGGACGCTGCAGAATGGCTCCCGCAAAGAAGGGTGGCGAGAAGAAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl