Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00174

HP ID(1) HP00174
Gene ID(2) 6218
Gene Symbol finder RPS17
Protein Name ribosomal protein S17
RefSeq NM_001021.3
Length of RefSeq (bp) 511
Chromosome 15q
Reference DDBJ accession
UniGene Hs.433427

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05H06 pKA1U5 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARe18F08 pKA1U5 GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
ARe20F03 pKA1U5 ATCCTGGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGA
ARe24G12 pKA1U5 GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
ARe32B02 pKA1U5 GGTTTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTG
ARe32F02 pKA1U5 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGAAGAAGG
ARe34G01 pKA1U5 GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGGC
ARe36F12 pKA1U5 GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
ARe54A10 pKA1U5 TTGCCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGATTCGCACCAAAACCGTGAAGAA
ARe63C01 pKA1U5 GCCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGAAGAAGG
ARe67H12 pKA1U5 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGG
ARe74H04 pKA1U5 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGG
ARe76C12 pKA1U5 ATCCTGGCTCTTTTACCAAGGGACCCGCCAACATNGGTCGCGCTTCGCACCAAAACCGTG
ARe84F02 pKA1U5 GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
ARe96H11 pKA1U5 ATCCTGGTGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTG
ARf07E03 pKA1U5 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARi05A11 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARi17E11 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARi24B12 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARi35H04 pGCAP10 GCCTCTTTTACCAAGGACCCGCCAACATGGTAGGTGTTTTGGCTCGAGGCCGCCATCCTC
ARi45F09 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARi46D05 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARi48A03 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARi67A06 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARi68G10 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGGGAAGAAGGC
ARi71A03 pGCAP10 GCTCTTTTACCAAGGACCCTCCAACATGGGCCGCGTTCGCAACAAAACTGTGAAAAANGC
ARiS008E17 pGCAP10 GCTCTTTTACCAAGGNCCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS020G14 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS020L10 pGCAP10 TGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
ARiS023A01 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS023K01 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS049E08 pGCAP10 GGNNGATTCCCCGGCNCTGCNNANGGAGGCGGCACTGGTCTCNACGTGGGGAAGAANGCG
ARiS055E21 pGCAP10 CGGCCGGCCGATGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAAC
ARiS085N02 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS085O05 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS096P10 pGCAP10 CGGCCGGCCGATGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAAC
ARiS122C13 pGCAP10 GCTCTTTTACCAAGGACCCNCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS122J13 pGCAP10 GCTCTTTTACNANGGACCCNCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS150E08 pGCAP10 CGGCCGGCCGATGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAAC
ARiS191B20 pGCAP10 TGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
ARiS191J01 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS194F22 pGCAP10 CCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
ARiS198L04 pGCAP10 TCAAAACGCCTCGGGGANCTGTTTGAATTTTTTCTGTAGTGCTGTATTATTTTCAATAAA
ARiS198P24 pGCAP10 TCAAAACGCCTCGGGGACCTGTTTGANTTTTTTCTGTAGTGCTGTATTATTTTCAATAAA
RBb02C12 pKA1U5 GCTCTTTTCCAAGGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGAAGAAGG
RBb03D02 pKA1U5 TGCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGG
RBb03G09 pKA1U5 GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGGC
RBb10E09 pKA1U5 GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGGC
RBb16C07 pKA1U5 GGTTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGA
RBb17H05 pKA1U5 GGTTTTTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGT
RBb21E06 pKA1U5 GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
RBb23F12 pGCAP1 GCTCTTTTACCAAGGTACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
RBb26G03 pGCAP1 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBb27B08 pGCAP1 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGTAAGAAGG
RBb30D03 pGCAP1 GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
RBb35C09 pGCAP1 GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAG
RBb37C09 pGCAP1 CTCTTTTACCAAGGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBb45A10 pGCAP1 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBb48B06 pGCAP1 TCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGG
RBb60A01 pGCAP1 ACTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAA
RBb61E01 pGCAP1 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBb62B12 pGCAP1 GGTTTNCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
RBb63A11 pGCAP1 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBb63G06 pGCAP1 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBb68B05 pGCAP1 GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
RBb72D11 pGCAP1 GGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
RBd04E11 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd07F06 pGCAP10 GGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
RBd12B01 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd14F12 pGCAP10 CGGCCGGCCGATGGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACC
RBd15A07 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGTAGGTGTTTTGGCTCGAGGCCGCCATCCTCC
RBd18G02 pGCAP10 CGGCCGGCCGATGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAAC
RBd20G10 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd22F11 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCNCCAAAACCGTGANANNNGN
RBd28E11 pGCAP10 GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
RBd33D11 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd34H03 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd37H02 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd43B07 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd46B05 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd51B07 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd58B01 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd60H05 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd65E10 pGCAP10 GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
RBd74A03 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd75A02 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd87C01 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBd91B09 pGCAP10 GTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAG
RBd95G02 pGCAP10 GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
RBd98B11 pGCAP10 GGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
RBdS007J03 pGCAP10 CGGCCGGCCGATATCGTGTGGCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCG
RBdS013G13 pGCAP10 GACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGG
RBdS014N08 pGCAP10 GCTCTTTTACCNNGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS014O16 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS015G23 pGCAP10 TGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
RBdS040I07 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS040M09 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS040P05 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS070H21 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS075M11 pGCAP10 GGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
RBdS083P19 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS104P15 pGCAP10 GGTTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAA
RBdS105P08 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS154P07 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS177I19 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
RBdS156H01 pGCAP10 GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl