Prev. |  KEGG KO K02962 > 

RIKEN DNA Bank Human Resource - RPS17

Gene ID NCBI Gene 6218 |  KEGG hsa:6218
Gene Symbol RPS17
Protein Name ribosomal protein S17
Synonyms DBA4|RPS17L|RPS17L1|RPS17L2|S17
Ortholog resources KEGG ortholog (KEGG orthology K02962) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX016845 IRAK042B21 pCMV-SPORT6 BC019899 NM_001021 Full
HGY091182 IRAL027P22 pOTB7 BC009407 NM_001021 Full
HGY095027 IRAL037J11 pDNR-LIB BC022370 NM_001021 Full
HGY098950 IRAL047G06 pOTB7 BC049824 NM_001021 Full
HGY100483 IRAL051D11 pDNR-LIB BC062715 NM_001021 Full
HGY103128 IRAL057N16 pDNR-LIB BC070222 NM_001021 Full
HGY103337 IRAL058F17 pOTB7 BC071928 NM_001021 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042174 ARe05H06 pKA1U5 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR047328 ARe18F08 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
HKR048123 ARe20F03 pKA1U5 NM_001021.3  
ATCCTGGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGA
HKR049756 ARe24G12 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
HKR052826 ARe32B02 pKA1U5 NM_001021.3  
GGTTTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTG
HKR052922 ARe32F02 pKA1U5 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGAAGAAGG
HKR053745 ARe34G01 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGGC
HKR054532 ARe36F12 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
HKR061610 ARe54A10 pKA1U5 NM_001021.3  
TTGCCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGATTCGCACCAAAACCGTGAAGAA
HKR065249 ARe63C01 pKA1U5 NM_001021.3  
GCCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGAAGAAGG
HKR066980 ARe67H12 pKA1U5 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGG
HKR069772 ARe74H04 pKA1U5 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGG
HKR070460 ARe76C12 pKA1U5 NM_001021.3  
ATCCTGGCTCTTTTACCAAGGGACCCGCCAACATNGGTCGCGCTTCGCACCAAAACCGTG
HKR073722 ARe84F02 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
HKR078579 ARe96H11 pKA1U5 NM_001021.3  
ATCCTGGTGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTG
HKR082899 ARf07E03 pKA1U5 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR162011 ARi05A11 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR166907 ARi17E11 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR169636 ARi24B12 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR174172 ARi35H04 pGCAP10 NM_001021.3  
GCCTCTTTTACCAAGGACCCGCCAACATGGTAGGTGTTTTGGCTCGAGGCCGCCATCCTC
HKR178129 ARi45F09 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR178477 ARi46D05 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR179203 ARi48A03 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR186806 ARi67A06 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR187354 ARi68G10 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGGGAAGAAGGC
HKR188403 ARi71A03 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCTCCAACATGGGCCGCGTTCGCAACAAAACTGTGAAAAANGC
HKR203313 ARiS008E17 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGNCCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR208158 ARiS020G14 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR208274 ARiS020L10 pGCAP10 NM_001021.3  
TGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR209201 ARiS023A01 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR209441 ARiS023K01 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR219704 ARiS049E08 pGCAP10 NM_001021.3  
GGNNGATTCCCCGGCNCTGCNNANGGAGGCGGCACTGGTCTCNACGTGGGGAAGAANGCG
HKR222117 ARiS055E21 pGCAP10 NM_001021.3  
CGGCCGGCCGATGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAAC
HKR234314 ARiS085N02 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR234341 ARiS085O05 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR238770 ARiS096P10 pGCAP10 NM_001021.3  
CGGCCGGCCGATGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAAC
HKR248861 ARiS122C13 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCNCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR249029 ARiS122J13 pGCAP10 NM_001021.3  
GCTCTTTTACNANGGACCCNCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR260104 ARiS150E08 pGCAP10 NM_001021.3  
CGGCCGGCCGATGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAAC
HKR276444 ARiS191B20 pGCAP10 NM_001021.3  
TGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR276617 ARiS191J01 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR277742 ARiS194F22 pGCAP10 NM_001021.3  
CCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR279468 ARiS198L04 pGCAP10 NM_001021.3  
TCAAAACGCCTCGGGGANCTGTTTGAATTTTTTCTGTAGTGCTGTATTATTTTCAATAAA
HKR279584 ARiS198P24 pGCAP10 NM_001021.3  
TCAAAACGCCTCGGGGACCTGTTTGANTTTTTTCTGTAGTGCTGTATTATTTTCAATAAA
HKR320860 RBb02C12 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGAAGAAGG
HKR321274 RBb03D02 pKA1U5 NM_001021.3  
TGCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGG
HKR321353 RBb03G09 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGGC
HKR324105 RBb10E09 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAGGC
HKR326455 RBb16C07 pKA1U5 NM_001021.3  
GGTTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGNTTCGCACCAAAACCGTGA
HKR326973 RBb17H05 pKA1U5 NM_001021.3  
GGTTTTTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGT
HKR328502 RBb21E06 pKA1U5 NM_001021.3  
GCTCTTTTCCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCG
HKR329332 RBb23F12 pGCAP1 NM_001021.3  
GCTCTTTTACCAAGGTACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR330547 RBb26G03 pGCAP1 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR330832 RBb27B08 pGCAP1 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGTAAGAAGG
HKR332075 RBb30D03 pGCAP1 NM_001021.3  
GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR334057 RBb35C09 pGCAP1 NM_001021.3  
GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTTCGCACCAAAACCGTGAAGAAG
HKR334857 RBb37C09 pGCAP1 NM_001021.3  
CTCTTTTACCAAGGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR338010 RBb45A10 pGCAP1 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR339230 RBb48B06 pGCAP1 NM_001021.3  
TCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGG
HKR344001 RBb60A01 pGCAP1 NM_001021.3  
ACTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAA
HKR344497 RBb61E01 pGCAP1 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR344836 RBb62B12 pGCAP1 NM_001021.3  
GGTTTNCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
HKR345211 RBb63A11 pGCAP1 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR345350 RBb63G06 pGCAP1 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR347229 RBb68B05 pGCAP1 NM_001021.3  
GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR348883 RBb72D11 pGCAP1 NM_001021.3  
GGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
HKR361707 RBd04E11 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR362926 RBd07F06 pGCAP10 NM_001021.3  
GGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
HKR364825 RBd12B01 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR365732 RBd14F12 pGCAP10 NM_001021.3  
CGGCCGGCCGATGGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACC
HKR366007 RBd15A07 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGTAGGTGTTTTGGCTCGAGGCCGCCATCCTCC
HKR367346 RBd18G02 pGCAP10 NM_001021.3  
CGGCCGGCCGATGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAAC
HKR368154 RBd20G10 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR368931 RBd22F11 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCNCCAAAACCGTGANANNNGN
HKR371307 RBd28E11 pGCAP10 NM_001021.3  
GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR373283 RBd33D11 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR373771 RBd34H03 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR374970 RBd37H02 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR377231 RBd43B07 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR378429 RBd46B05 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR380431 RBd51B07 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR383225 RBd58B01 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR384173 RBd60H05 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR386106 RBd65E10 pGCAP10 NM_001021.3  
GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR389603 RBd74A03 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR390002 RBd75A02 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR394849 RBd87C01 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR396433 RBd91B09 pGCAP10 NM_001021.3  
GTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAG
HKR398146 RBd95G02 pGCAP10 NM_001021.3  
GCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR399235 RBd98B11 pGCAP10 NM_001021.3  
GGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
HKR403019 RBdS007J03 pGCAP10 NM_001021.3  
CGGCCGGCCGATATCGTGTGGCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCG
HKR405357 RBdS013G13 pGCAP10 NM_001021.3  
GACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGG
HKR405920 RBdS014N08 pGCAP10 NM_001021.3  
GCTCTTTTACCNNGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR405952 RBdS014O16 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR406167 RBdS015G23 pGCAP10 NM_001021.3  
TGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
HKR416199 RBdS040I07 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR416297 RBdS040M09 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR416365 RBdS040P05 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR428189 RBdS070H21 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR430299 RBdS075M11 pGCAP10 NM_001021.3  
GGTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAG
HKR433579 RBdS083P19 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR441975 RBdS104P15 pGCAP10 NM_001021.3  
GGTTTTCCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAA
HKR442368 RBdS105P08 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR461967 RBdS154P07 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR462569 RBdS156H01 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC
HKR471011 RBdS177I19 pGCAP10 NM_001021.3  
GCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl