Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015G23

Clone ID RBdS015G23
HP ID HP00174
Gene ID 6218
Gene Symbol RPS17
Protein Name ribosomal protein S17
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001021.3
Length of RefSeq (bp) 511
Chromosome 15q
Reference DDBJ accession
UniGene Hs.433427
5'-terminal sequence TGCTCTTTTACCAAGGACCCGCCAACATGGGCCGCGTTCGCACCAAAACCGTGAAGAAGG
2011.08.28