Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00168

HP ID(1) HP00168
Gene ID(2) 6206
Gene Symbol finder RPS12
Protein Name ribosomal protein S12
RefSeq NM_001016.3
Length of RefSeq (bp) 532
Chromosome 6q23.2
Reference DDBJ accession
UniGene Hs.546289

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02G09 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe09E08 pKA1U5 CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
ARe22G10 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe36E01 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe39D03 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe39F11 pKA1U5 NNNNNNNCCTCGCCGCCGCCGAGTCGCGCGNCCCGNNNAGGCTTGGGTGCGTTCAAGATT
ARe40B01 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe44D07 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGNAGGCTTGGGTGCGTTCAAGATTC
ARe45H02 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe47B09 pKA1U5 CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
ARe51G04 pKA1U5 TTTGGCAGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTC
ARe53C07 pKA1U5 GCTCTTTCCCTGCCGCCGCCGCAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
ARe60C05 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe60G02 pKA1U5 GNTTACCCTGCCGCCACCCANTCNCNCGGAGGCCGAGGCTTGNGTGCNTTCAAGATTCAA
ARe63C12 pKA1U5 CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
ARe67E12 pKA1U5 ATCCTGCTCTTTCCCTGCCGCCGCCGAGTCGCCCNTTNGGCGGAGGCTTGGGTGCGTTCA
ARe68B03 pKA1U5 CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
ARe79E06 pKA1U5 TCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe81D06 pKA1U5 TAGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGAT
ARe83G08 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe90G09 pKA1U5 ATCCTGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAA
ARe92E08 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe96D02 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARf05E06 pKA1U5 ATCCTGTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAG
ARf06E05 pKA1U5 GCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAA
ARi08G08 pGCAP10 CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
ARi08H12 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi12B04 pGCAP10 TCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi12F01 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi24H03 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi26E01 pGCAP10 CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
ARi27D06 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi36C10 pGCAP10 TGGTGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAG
ARi43G02 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi50B04 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi50E12 pGCAP10 CGGCCGGCCGATGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTG
ARi51E01 pGCAP10 CTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAAC
ARi51H08 pGCAP10 TCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi56D04 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARi60H05 pGCAP10 CGGCCGGCCGATGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTG
ARi61G09 pGCAP10 GCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAG
ARiS008C06 pGCAP10 GCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAG
ARiS008G20 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS008J18 pGCAP10 CTTTTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS013H18 pGCAP10 GTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAGC
ARiS013P20 pGCAP10 CCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS023F12 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS085K19 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS088A18 pGCAP10 TCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAA
ARiS088O11 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS150K02 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS150O22 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS161B07 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS191C07 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARiS191D03 pGCAP10 TGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
RBb04A03 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBb10C10 pKA1U5 TGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
RBb21G02 pKA1U5 TTTTGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAG
RBb23B02 pGCAP1 ATCTCTTTCCCTGCCGCCGCCGAGTTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGAT
RBb56C07 pGCAP1 GCCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
RBd03H06 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBd35A08 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBd39F04 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBd43F02 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBd56G02 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBd67F07 pGCAP10 GCTTTTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
RBd84G04 pGCAP10 GGTTGCACTCGCCAAGGACCGGCCTGGCAGAGATAGAAAACTCGCAGTACGTTTGCCTCA
RBd85F06 pGCAP10 GCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAA
RBd92B01 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS015H20 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS081F08 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS081N24 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS105E04 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS156G11 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS156K21 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS187D07 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS187M08 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
ARe51F05 pKA1U5 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
RBdS187J16 pGCAP10 GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl