Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015H20

Clone ID RBdS015H20
HP ID HP00168
Gene ID 6206
Gene Symbol RPS12
Protein Name ribosomal protein S12
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001016.3
Length of RefSeq (bp) 532
Chromosome 6q23.2
Reference DDBJ accession
UniGene Hs.546289
5'-terminal sequence GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
2011.08.28