Prev. |  KEGG KO K02951 > 

RIKEN DNA Bank Human Resource - RPS12

Gene ID NCBI Gene 6206 |  KEGG hsa:6206
Gene Symbol RPS12
Protein Name ribosomal protein S12
Synonyms S12
Ortholog resources KEGG ortholog (KEGG orthology K02951) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095673 IRAL039D01 pOTB7 BC017321 NM_001016 Full
HGY103463 IRAL058K23 pOTB7 BC071930 NM_001016 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040953 ARe02G09 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR043704 ARe09E08 pKA1U5 NM_001016.3  
CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
HKR048954 ARe22G10 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR054497 ARe36E01 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR055675 ARe39D03 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR055731 ARe39F11 pKA1U5 NM_001016.3  
NNNNNNNCCTCGCCGCCGCCGAGTCGCGCGNCCCGNNNAGGCTTGGGTGCGTTCAAGATT
HKR056025 ARe40B01 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR057679 ARe44D07 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGNAGGCTTGGGTGCGTTCAAGATTC
HKR058170 ARe45H02 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR058833 ARe47B09 pKA1U5 NM_001016.3  
CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
HKR060525 ARe51F05 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR060548 ARe51G04 pKA1U5 NM_001016.3  
TTTGGCAGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTC
HKR061255 ARe53C07 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGCAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
HKR064053 ARe60C05 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR064146 ARe60G02 pKA1U5 NM_001016.3  
GNTTACCCTGCCGCCACCCANTCNCNCGGAGGCCGAGGCTTGNGTGCNTTCAAGATTCAA
HKR065260 ARe63C12 pKA1U5 NM_001016.3  
CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
HKR066908 ARe67E12 pKA1U5 NM_001016.3  
ATCCTGCTCTTTCCCTGCCGCCGCCGAGTCGCCCNTTNGGCGGAGGCTTGGGTGCGTTCA
HKR067227 ARe68B03 pKA1U5 NM_001016.3  
CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
HKR071702 ARe79E06 pKA1U5 NM_001016.3  
TCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR072478 ARe81D06 pKA1U5 NM_001016.3  
TAGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGAT
HKR073352 ARe83G08 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR076153 ARe90G09 pKA1U5 NM_001016.3  
ATCCTGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAA
HKR076904 ARe92E08 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR078474 ARe96D02 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR082102 ARf05E06 pKA1U5 NM_001016.3  
ATCCTGTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAG
HKR082501 ARf06E05 pKA1U5 NM_001016.3  
GCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAA
HKR163352 ARi08G08 pGCAP10 NM_001016.3  
CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
HKR163380 ARi08H12 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR164828 ARi12B04 pGCAP10 NM_001016.3  
TCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR164921 ARi12F01 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR169771 ARi24H03 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR170497 ARi26E01 pGCAP10 NM_001016.3  
CTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCA
HKR170878 ARi27D06 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR174458 ARi36C10 pGCAP10 NM_001016.3  
TGGTGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAG
HKR177346 ARi43G02 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR180028 ARi50B04 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR180108 ARi50E12 pGCAP10 NM_001016.3  
CGGCCGGCCGATGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTG
HKR180497 ARi51E01 pGCAP10 NM_001016.3  
CTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAAC
HKR180576 ARi51H08 pGCAP10 NM_001016.3  
TCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR182476 ARi56D04 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR184173 ARi60H05 pGCAP10 NM_001016.3  
CGGCCGGCCGATGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTG
HKR184553 ARi61G09 pGCAP10 NM_001016.3  
GCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAG
HKR203254 ARiS008C06 pGCAP10 NM_001016.3  
GCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAG
HKR203364 ARiS008G20 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR203434 ARiS008J18 pGCAP10 NM_001016.3  
CTTTTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR205386 ARiS013H18 pGCAP10 NM_001016.3  
GTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAGC
HKR205580 ARiS013P20 pGCAP10 NM_001016.3  
CCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR209332 ARiS023F12 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR234259 ARiS085K19 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR235218 ARiS088A18 pGCAP10 NM_001016.3  
TCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAA
HKR235547 ARiS088O11 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR260242 ARiS150K02 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR260358 ARiS150O22 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR264431 ARiS161B07 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR276455 ARiS191C07 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR276475 ARiS191D03 pGCAP10 NM_001016.3  
TGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
HKR321603 RBb04A03 pKA1U5 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR324058 RBb10C10 pKA1U5 NM_001016.3  
TGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
HKR328546 RBb21G02 pKA1U5 NM_001016.3  
TTTTGCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAG
HKR329226 RBb23B02 pGCAP1 NM_001016.3  
ATCTCTTTCCCTGCCGCCGCCGAGTTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGAT
HKR342455 RBb56C07 pGCAP1 NM_001016.3  
GCCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
HKR361374 RBd03H06 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR374008 RBd35A08 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR375724 RBd39F04 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR377322 RBd43F02 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR382546 RBd56G02 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR386927 RBd67F07 pGCAP10 NM_001016.3  
GCTTTTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATT
HKR393748 RBd84G04 pGCAP10 NM_001016.3  
GGTTGCACTCGCCAAGGACCGGCCTGGCAGAGATAGAAAACTCGCAGTACGTTTGCCTCA
HKR394126 RBd85F06 pGCAP10 NM_001016.3  
GCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTCAA
HKR396825 RBd92B01 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR406188 RBdS015H20 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR432528 RBdS081F08 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR432736 RBdS081N24 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR442100 RBdS105E04 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR462555 RBdS156G11 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR462661 RBdS156K21 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR474879 RBdS187D07 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR475032 RBdS187J16 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC
HKR475096 RBdS187M08 pGCAP10 NM_001016.3  
GCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGTGCGTTCAAGATTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl