Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00133

HP ID(1) HP00133
Gene ID(2) 6230
Gene Symbol finder RPS25
Protein Name ribosomal protein S25
RefSeq NM_001028.2
Length of RefSeq (bp) 514
Chromosome 1q23.3
Reference DDBJ accession
UniGene Hs.512676

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02C12 pKA1U5 ATCCTGGCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGC
ARe06F12 pKA1U5 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARe07C11 pKA1U5 ATCCTGGTACTTTTTTTTTTTTTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTG
ARe22D05 pKA1U5 CCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARe31A04 pKA1U5 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARe42G03 pKA1U5 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARe58E05 pKA1U5 GTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
ARe61B07 pKA1U5 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGCGTTCTGCGTGCTATTCTCCGAGCTTC
ARe72G09 pKA1U5 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARe74B01 pKA1U5 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARe74D10 pKA1U5 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARe85G03 pKA1U5 TGGCGCTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGC
ARe86B12 pKA1U5 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARe88C10 pKA1U5 GTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
ARe96C04 pKA1U5 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARf05A11 pKA1U5 GTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
ARi05A02 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARi06F03 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARi06F10 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARi13D07 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
ARi15E08 pGCAP10 AGGGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAG
ARi19E12 pGCAP10 GTTTATGGCCCTCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCTCGGG
ARi22E03 pGCAP10 GCTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARi23H01 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARi26D02 pGCAP10 GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
ARi27H04 pGCAP10 GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
ARi29E06 pGCAP10 GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
ARi32B12 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARi33B12 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARi34B01 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARi35E10 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARi38E07 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARi47C05 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARi52E06 pGCAP10 GCTCCTCCTCCTCCCGCGCCCTCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGA
ARiS008D09 pGCAP10 GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
ARiS008K04 pGCAP10 CTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARiS020E15 pGCAP10 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGT
ARiS085H02 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARiS087K16 pGCAP10 NGNCCNCCTCTNNNCNAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCGC
ARiS088N07 pGCAP10 GGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCG
ARiS109M22 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
ARiS118A05 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARiS122P15 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
ARiS161A09 pGCAP10 GAGCCTCCTCCTCCTCCTTCACCTCCTCCTCCTCCCGCGCCCTCCGTGCAGCCACCTGCT
ARiS161H13 pGCAP10 GCTTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCT
ARiS198E11 pGCAP10 GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
ARiS198G22 pGCAP10
RBb18H09 pKA1U5 GCTCCTCCCGCGCCCCCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCT
RBb58B09 pGCAP1 GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
RBd07C06 pGCAP10 GCTTTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
RBd11C09 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd14B07 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd28D11 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd33F03 pGCAP10 TGCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
RBd47A06 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd47A10 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd51D08 pGCAP10 GGTTTTCTGAGCAGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTG
RBd55C10 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCNNTTNTCCGAGCTTCGCA
RBd72F04 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd76H12 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
RBd90B04 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd90F02 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd92D05 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBd93C10 pGCAP10 GCTTTTTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGC
RBd94F07 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
RBdS014A13 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBdS014A21 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBdS015L11 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
RBdS075C13 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBdS075F13 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBdS075J23 pGCAP10 GGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCG
RBdS075M23 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBdS081G07 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBdS081I02 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
RBdS081I05 pGCAP10 GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
RBdS081J23 pGCAP10 GGCTTTTTTTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
RBdS083I09 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBdS105D24 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
RBdS110G07 pGCAP10 GAGTACTCACAGCGGACGGTGGTTTTTGGGCCCGTTTCTGAGCAGCGCTTCCTTTTTGTC
RBdS110O02 pGCAP10 GGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAG
RBdS177K20 pGCAP10 GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl