Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075J23

Clone ID RBdS075J23
HP ID HP00133
Gene ID 6230
Gene Symbol RPS25
Protein Name ribosomal protein S25
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001028.2
Length of RefSeq (bp) 514
Chromosome 1q23.3
Reference DDBJ accession
UniGene Hs.512676
5'-terminal sequence GGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCG
2011.08.28