Prev. |  KEGG KO K02975 > 

RIKEN DNA Bank Human Resource - RPS25

Gene ID NCBI Gene 6230 |  KEGG hsa:6230
Gene Symbol RPS25
Protein Name ribosomal protein S25
Synonyms S25
Ortholog resources KEGG ortholog (KEGG orthology K02975) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083772 IRAL009H04 pOTB7 BC004986 NM_001028 Full
HGY085361 IRAL013G17 pOTB7 BC003537 NM_001028 Full
HGY085581 IRAL013P21 pOTB7 BC004294 NM_001028 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097633 M01C044B09 pDONR221 MGC11-G05 BC004986 NM_001028  
HGE097681 M01C044D09 pDONR221 MGC11-G05 BC004986 NM_001028  
HGE097729 M01C044F09 pDONR221 MGC11-G05 BC004986 NM_001028  
HGE097777 M01C044H09 pDONR221 MGC11-G05 BC004986 NM_001028  
HGE097825 M01C044J09 pDONR221 MGC11-G05 BC004986 NM_001028  
HGE097873 M01C044L09 pDONR221 MGC11-G05 BC004986 NM_001028  
HGE097921 M01C044N09 pDONR221 MGC11-G05 BC004986 NM_001028  
HGE097969 M01C044P09 pDONR221 MGC11-G05 BC004986 NM_001028  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040860 ARe02C12 pKA1U5 NM_001028.2  
ATCCTGGCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGC
HKR042532 ARe06F12 pKA1U5 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR042859 ARe07C11 pKA1U5 NM_001028.2  
ATCCTGGTACTTTTTTTTTTTTTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTG
HKR048877 ARe22D05 pKA1U5 NM_001028.2  
CCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR052404 ARe31A04 pKA1U5 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR056947 ARe42G03 pKA1U5 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR063301 ARe58E05 pKA1U5 NM_001028.2  
GTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
HKR064431 ARe61B07 pKA1U5 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGCGTTCTGCGTGCTATTCTCCGAGCTTC
HKR068953 ARe72G09 pKA1U5 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR069625 ARe74B01 pKA1U5 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR069682 ARe74D10 pKA1U5 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR074147 ARe85G03 pKA1U5 NM_001028.2  
TGGCGCTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGC
HKR074436 ARe86B12 pKA1U5 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR075258 ARe88C10 pKA1U5 NM_001028.2  
GTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
HKR078452 ARe96C04 pKA1U5 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR082011 ARf05A11 pKA1U5 NM_001028.2  
GTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
HKR162002 ARi05A02 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR162523 ARi06F03 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR162530 ARi06F10 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR165279 ARi13D07 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
HKR166104 ARi15E08 pGCAP10 NM_001028.2  
AGGGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAG
HKR167708 ARi19E12 pGCAP10 NM_001028.2  
GTTTATGGCCCTCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCTCGGG
HKR168899 ARi22E03 pGCAP10 NM_001028.2  
GCTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR169369 ARi23H01 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR170474 ARi26D02 pGCAP10 NM_001028.2  
GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
HKR170972 ARi27H04 pGCAP10 NM_001028.2  
GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
HKR171702 ARi29E06 pGCAP10 NM_001028.2  
GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
HKR172836 ARi32B12 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR173236 ARi33B12 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR173625 ARi34B01 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR174106 ARi35E10 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR175303 ARi38E07 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR178853 ARi47C05 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR180902 ARi52E06 pGCAP10 NM_001028.2  
GCTCCTCCTCCTCCCGCGCCCTCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGA
HKR203281 ARiS008D09 pGCAP10 NM_001028.2  
GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
HKR203444 ARiS008K04 pGCAP10 NM_001028.2  
CTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR208111 ARiS020E15 pGCAP10 NM_001028.2  
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGT
HKR234170 ARiS085H02 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR235056 ARiS087K16 pGCAP10 NM_001028.2  
NGNCCNCCTCTNNNCNAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCGC
HKR235519 ARiS088N07 pGCAP10 NM_001028.2  
GGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCG
HKR243910 ARiS109M22 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR247205 ARiS118A05 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR249175 ARiS122P15 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR264409 ARiS161A09 pGCAP10 NM_001028.2  
GAGCCTCCTCCTCCTCCTTCACCTCCTCCTCCTCCCGCGCCCTCCGTGCAGCCACCTGCT
HKR264581 ARiS161H13 pGCAP10 NM_001028.2  
GCTTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCT
HKR279307 ARiS198E11 pGCAP10 NM_001028.2  
GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
HKR279366 ARiS198G22 pGCAP10 NM_001028.2  
HKR327377 RBb18H09 pKA1U5 NM_001028.2  
GCTCCTCCCGCGCCCCCCGTGCAGCCACCTGCTGCACTTGCGCACTGGGAGCGACACGCT
HKR343233 RBb58B09 pGCAP1 NM_001028.2  
GCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
HKR362854 RBd07C06 pGCAP10 NM_001028.2  
GCTTTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTT
HKR364457 RBd11C09 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR365631 RBd14B07 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR371283 RBd28D11 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR373323 RBd33F03 pGCAP10 NM_001028.2  
TGCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCG
HKR378806 RBd47A06 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR378810 RBd47A10 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR380480 RBd51D08 pGCAP10 NM_001028.2  
GGTTTTCTGAGCAGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTG
HKR382058 RBd55C10 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCNNTTNTCCGAGCTTCGCA
HKR388924 RBd72F04 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR390580 RBd76H12 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR396028 RBd90B04 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR396122 RBd90F02 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR396877 RBd92D05 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR397258 RBd93C10 pGCAP10 NM_001028.2  
GCTTTTTTTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGC
HKR397727 RBd94F07 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR405613 RBdS014A13 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR405621 RBdS014A21 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR406275 RBdS015L11 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR430061 RBdS075C13 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR430133 RBdS075F13 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR430239 RBdS075J23 pGCAP10 NM_001028.2  
GGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCG
HKR430311 RBdS075M23 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR432551 RBdS081G07 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR432594 RBdS081I02 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR432597 RBdS081I05 pGCAP10 NM_001028.2  
GCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR432639 RBdS081J23 pGCAP10 NM_001028.2  
GGCTTTTTTTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGC
HKR433401 RBdS083I09 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR442096 RBdS105D24 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA
HKR444151 RBdS110G07 pGCAP10 NM_001028.2  
GAGTACTCACAGCGGACGGTGGTTTTTGGGCCCGTTTCTGAGCAGCGCTTCCTTTTTGTC
HKR444338 RBdS110O02 pGCAP10 NM_001028.2  
GGCGCTTCCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAG
HKR471060 RBdS177K20 pGCAP10 NM_001028.2  
GCTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl