Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00130

HP ID(1) HP00130
Gene ID(2) 6129
Gene Symbol finder RPL7
Protein Name ribosomal protein L7
RefSeq NM_000971.2
Length of RefSeq (bp) 838
Chromosome 8q13.3
Reference DDBJ accession
UniGene Hs.571841

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01F03 pKA1U5 ATCCTGCTCTTTTTCCGGCTGGAACCATGGAGNGTNTAGAAGAGAAGAAGAAGGAGGTTC
ARe17G06 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARe26D08 pKA1U5 TTTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
ARe26F03 pKA1U5 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARe28C02 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARe36E12 pKA1U5 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARe38H11 pKA1U5 GCTCTTTTTTTCCGGCTGGAACCATGGCAGGGTGTNGNAANAGAAGAAGAAGGAGGTTCC
ARe40D11 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGTAGGGTGTANAAGAGAAGAAGAAGGAGGTTCCTGC
ARe41C11 pKA1U5 TTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGC
ARe44G08 pKA1U5 GGACTCGCACTGAAGCGCCGATTCCTGGCTTTTGCAAGGCTGTGGTCGGTGGTCATCAGT
ARe44G09 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTANAANAGAAGAAGAAGGAGGTTCCTGCT
ARe45B04 pKA1U5 AAGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCT
ARe49B10 pKA1U5 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARe50B03 pKA1U5 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARe50G03 pKA1U5 TGGTCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCC
ARe51A06 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARe51C11 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARe52B04 pKA1U5 GCCTCTTTTTCCGGCTGGAACCATGGTAGGGTGTNCAAGAGAAGAAGATGGAGGTTCCTG
ARe59B11 pKA1U5 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARe59E12 pKA1U5 GCCTCTTTTTCCGGCTGGAACCATGGTAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
ARe61C04 pKA1U5 TGGCCTCTTTTTCCGGCTGGAACCATGGAGGGCGTATAAGAGAAGAAGAAGGAGGTTCCT
ARe64E12 pKA1U5 TTGGCGTTTGTCATCAGAATCAGAGGTATCAATGGAGTGAGCCCAAAGGTTCGAAAGGTG
ARe77E04 pKA1U5 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTNGAAGAGAAGAAGAAGGAGGTTCCTGC
ARe78F07 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARe79G03 pKA1U5 ATCCTGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTC
ARe83C03 pKA1U5 GCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
ARe84C03 pKA1U5 ATCCTGGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGT
ARe86B08 pKA1U5 TTGGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCT
ARe86G06 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARe87H05 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARe97D01 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARf01F03 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi02H11 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi05A01 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi06C10 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi08F02 pGCAP10 GCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGA
ARi08H10 pGCAP10 TGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi09H01 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi11B06 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi11H06 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi15F03 pGCAP10 TGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
ARi18B11 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi24E07 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi28H03 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi30A12 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi33E03 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi35D11 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi36D09 pGCAP10 TGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi37C04 pGCAP10 GCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGA
ARi42H05 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi48D07 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi49E12 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi50E07 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi56D11 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi58H02 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi60D11 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi61C01 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi62A08 pGCAP10 TCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARi64E02 pGCAP10
ARi68B10 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARi71C06 pGCAP10 GCTCTTTTTCCGGGTGGAACCATGGAGGGTGAAGAAGAGAATAANAAGGANGTTCCNANG
ARi71D06 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS013K02 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS020P17 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS023A17 pGCAP10 GCTCTTTNNNNGGCTGGAACCATGGAGGGTGTAGAAGANAAGAAGAAGGAGGTTCCTGCT
ARiS045G15 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS045H10 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARiS045L12 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS045N06 pGCAP10 GCTCTTTTTCCGGCTGGAACCNTNNAGGGTGTANAAAAAAANAANAAGGAGGTTCCTGCT
ARiS049J06 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS055B08 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS055L07 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARiS055M13 pGCAP10 TTGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCT
ARiS085G08 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS087G24 pGCAP10 GCCGGCCGNGNCCGCNNCCNCANCCCTCCTCGCACCTCCCTTCGCAGCTCACGCCCCCTC
ARiS109E18 pGCAP10 TTGGCGGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTT
ARiS122A16 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS122D16 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS122I06 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS122J12 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARiS122M20 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS122O20 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
ARiS150F14 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARiS191F01 pGCAP10 CGGCCGGCCGATGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAG
ARiS191F13 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
ARiS191G21 pGCAP10 GTTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
ARiS198F17 pGCAP10
ARiS198P18 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBb02B09 pKA1U5 TCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBb03C03 pKA1U5 GCCTTCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTC
RBb06F05 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTCNAATTAGAAGAAGAAGGAGGTTCCTGC
RBb14C10 pKA1U5 GCTCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
RBb15E10 pKA1U5 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBb35G12 pGCAP1 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBb47E08 pGCAP1 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBb62C05 pGCAP1 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGNGAAGAAGAAGGAGGTTCCTGCT
RBb64B05 pGCAP1 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBd07A08 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd13G03 pGCAP10 GCTCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
RBd15B10 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd15D09 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd25D03 pGCAP10 GTCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
RBd28G06 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd30G06 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAAGGTGTAGAAGAGAATAAGAAGGAGGTTCCTGCT
RBd32G01 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd39C09 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd50E01 pGCAP10 GCCTCTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTG
RBd53G07 pGCAP10 GCTTTAAGTGGACAGTACGCATGCGCCAACTTCCTCTTTTTCCGNNTGGAACCATGGAGG
RBd55H10 pGCAP10 GTCTTTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGANGNNNNAGGAGGTTCCTGC
RBd61H02 pGCAP10 GACGCATGCGCCAACTTCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGA
RBd66D12 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd69H01 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd75G02 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd75H07 pGCAP10 GGTCGCCGGCTCAGTTGGGGCGGAACACTTTGANCCTTTTCTTGGATGATGCTTGCTTCC
RBd86A01 pGCAP10 GCTCTTTTTCCCCCTGGAACCATGGACGGTGTAGAAAACTGCCTCCCCGAGGTTCCCGCT
RBd86B01 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd88D02 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd90D11 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAACAAGAAGGAGGTTCCTGCT
RBd92B03 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBd95B02 pGCAP10 CGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
RBd97A06 pGCAP10 GCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
RBd97D10 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS007C07 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBdS007E03 pGCAP10 TGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBdS007P18 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS013O03 pGCAP10 CCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS013O24 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBdS014L08 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS015J21 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS022G23 pGCAP10 GCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
RBdS040C15 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS070A12 pGCAP10 CGGCCGGCCGATGAGTACGCATGCGCCAACTTCCTCTTTTTCCGGCTGGAACCATGGAGG
RBdS075M16 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS083K09 pGCAP10 GCCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
RBdS104B20 pGCAP10 GTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTG
RBdS105P19 pGCAP10 GGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGAAA
RBdS110F22 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBdS110O08 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS132H06 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBdS154F08 pGCAP10 GCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGA
RBdS156A05 pGCAP10 GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
RBdS156P04 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
RBdS187M06 pGCAP10 GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl