Prev. |  KEGG KO K02937 > 

RIKEN DNA Bank Human Resource - RPL7

Gene ID NCBI Gene 6129 |  KEGG hsa:6129
Gene Symbol RPL7
Protein Name ribosomal protein L7
Synonyms L7|humL7-1
Ortholog resources KEGG ortholog (KEGG orthology K02937) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103134 IRAL057N22 pDNR-LIB BC070215 NM_000971.4 Partial
HGY087208 IRAL018A08 pOTB7 BC006095 NM_000971 Full
HGY088236 IRAL020J20 pOTB7 BC008850 NM_000971 Full
HGY088495 IRAL021D23 pDNR-LIB BC009599 NM_000971 Full
HGY103207 IRAL058A07 pOTB7 BC071894 NM_000971 Full
HGY103518 IRAL058N06 pOTB7 BC071895 NM_000971 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040523 ARe01F03 pKA1U5 NM_000971.2  
ATCCTGCTCTTTTTCCGGCTGGAACCATGGAGNGTNTAGAAGAGAAGAAGAAGGAGGTTC
HKR046950 ARe17G06 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR050480 ARe26D08 pKA1U5 NM_000971.2  
TTTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
HKR050523 ARe26F03 pKA1U5 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR051250 ARe28C02 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR054508 ARe36E12 pKA1U5 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR055379 ARe38H11 pKA1U5 NM_000971.2  
GCTCTTTTTTTCCGGCTGGAACCATGGCAGGGTGTNGNAANAGAAGAAGAAGGAGGTTCC
HKR056083 ARe40D11 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGTAGGGTGTANAAGAGAAGAAGAAGGAGGTTCCTGC
HKR056459 ARe41C11 pKA1U5 NM_000971.2  
TTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGC
HKR057752 ARe44G08 pKA1U5 NM_000971.2  
GGACTCGCACTGAAGCGCCGATTCCTGGCTTTTGCAAGGCTGTGGTCGGTGGTCATCAGT
HKR057753 ARe44G09 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTANAANAGAAGAAGAAGGAGGTTCCTGCT
HKR058028 ARe45B04 pKA1U5 NM_000971.2  
AAGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCT
HKR059634 ARe49B10 pKA1U5 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR060027 ARe50B03 pKA1U5 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR060147 ARe50G03 pKA1U5 NM_000971.2  
TGGTCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCC
HKR060406 ARe51A06 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR060459 ARe51C11 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR060828 ARe52B04 pKA1U5 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGTAGGGTGTNCAAGAGAAGAAGATGGAGGTTCCTG
HKR063635 ARe59B11 pKA1U5 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR063708 ARe59E12 pKA1U5 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGTAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
HKR064452 ARe61C04 pKA1U5 NM_000971.2  
TGGCCTCTTTTTCCGGCTGGAACCATGGAGGGCGTATAAGAGAAGAAGAAGGAGGTTCCT
HKR065708 ARe64E12 pKA1U5 NM_000971.2  
TTGGCGTTTGTCATCAGAATCAGAGGTATCAATGGAGTGAGCCCAAAGGTTCGAAAGGTG
HKR070900 ARe77E04 pKA1U5 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTNGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR071327 ARe78F07 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR071747 ARe79G03 pKA1U5 NM_000971.2  
ATCCTGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTC
HKR073251 ARe83C03 pKA1U5 NM_000971.2  
GCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
HKR073651 ARe84C03 pKA1U5 NM_000971.2  
ATCCTGGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGT
HKR074432 ARe86B08 pKA1U5 NM_000971.2  
TTGGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCT
HKR074550 ARe86G06 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR074973 ARe87H05 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR078873 ARe97D01 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR080523 ARf01F03 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR160979 ARi02H11 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR162001 ARi05A01 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR162458 ARi06C10 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR163322 ARi08F02 pGCAP10 NM_000971.2  
GCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGA
HKR163378 ARi08H10 pGCAP10 NM_000971.2  
TGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR163769 ARi09H01 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR164430 ARi11B06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR164574 ARi11H06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR166123 ARi15F03 pGCAP10 NM_000971.2  
TGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
HKR167235 ARi18B11 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR169703 ARi24E07 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR171371 ARi28H03 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR172012 ARi30A12 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR173299 ARi33E03 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR174083 ARi35D11 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR174481 ARi36D09 pGCAP10 NM_000971.2  
TGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR174852 ARi37C04 pGCAP10 NM_000971.2  
GCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGA
HKR176973 ARi42H05 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR179279 ARi48D07 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR179708 ARi49E12 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR180103 ARi50E07 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR182483 ARi56D11 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR183370 ARi58H02 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR184083 ARi60D11 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR184449 ARi61C01 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR184808 ARi62A08 pGCAP10 NM_000971.2  
TCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR185698 ARi64E02 pGCAP10 NM_000971.2  
HKR187234 ARi68B10 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR188454 ARi71C06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGGTGGAACCATGGAGGGTGAAGAAGAGAATAANAAGGANGTTCCNANG
HKR188478 ARi71D06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR205442 ARiS013K02 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR208377 ARiS020P17 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR209217 ARiS023A17 pGCAP10 NM_000971.2  
GCTCTTTNNNNGGCTGGAACCATGGAGGGTGTAGAAGANAAGAAGAAGGAGGTTCCTGCT
HKR218159 ARiS045G15 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR218178 ARiS045H10 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR218276 ARiS045L12 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR218318 ARiS045N06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCNTNNAGGGTGTANAAAAAAANAANAAGGAGGTTCCTGCT
HKR219822 ARiS049J06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR222032 ARiS055B08 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR222271 ARiS055L07 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR222301 ARiS055M13 pGCAP10 NM_000971.2  
TTGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCT
HKR234152 ARiS085G08 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR234968 ARiS087G24 pGCAP10 NM_000971.2  
GCCGGCCGNGNCCGCNNCCNCANCCCTCCTCGCACCTCCCTTCGCAGCTCACGCCCCCTC
HKR243714 ARiS109E18 pGCAP10 NM_000971.2  
TTGGCGGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTT
HKR248816 ARiS122A16 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR248888 ARiS122D16 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR248998 ARiS122I06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR249028 ARiS122J12 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR249108 ARiS122M20 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR249156 ARiS122O20 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR260134 ARiS150F14 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR276521 ARiS191F01 pGCAP10 NM_000971.2  
CGGCCGGCCGATGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAG
HKR276533 ARiS191F13 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR276565 ARiS191G21 pGCAP10 NM_000971.2  
GTTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
HKR279337 ARiS198F17 pGCAP10 NM_000971.2  
HKR279578 ARiS198P18 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR320833 RBb02B09 pKA1U5 NM_000971.2  
TCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR321251 RBb03C03 pKA1U5 NM_000971.2  
GCCTTCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTC
HKR322525 RBb06F05 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTCNAATTAGAAGAAGAAGGAGGTTCCTGC
HKR325658 RBb14C10 pKA1U5 NM_000971.2  
GCTCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
HKR326106 RBb15E10 pKA1U5 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR334156 RBb35G12 pGCAP1 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR338904 RBb47E08 pGCAP1 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR344853 RBb62C05 pGCAP1 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGNGAAGAAGAAGGAGGTTCCTGCT
HKR345629 RBb64B05 pGCAP1 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR362808 RBd07A08 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR365347 RBd13G03 pGCAP10 NM_000971.2  
GCTCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
HKR366034 RBd15B10 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR366081 RBd15D09 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR370075 RBd25D03 pGCAP10 NM_000971.2  
GTCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
HKR371350 RBd28G06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR372150 RBd30G06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAAGGTGTAGAAGAGAATAAGAAGGAGGTTCCTGCT
HKR372945 RBd32G01 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR375657 RBd39C09 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR380097 RBd50E01 pGCAP10 NM_000971.2  
GCCTCTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTG
HKR381351 RBd53G07 pGCAP10 NM_000971.2  
GCTTTAAGTGGACAGTACGCATGCGCCAACTTCCTCTTTTTCCGNNTGGAACCATGGAGG
HKR382178 RBd55H10 pGCAP10 NM_000971.2  
GTCTTTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGANGNNNNAGGAGGTTCCTGC
HKR384570 RBd61H02 pGCAP10 NM_000971.2  
GACGCATGCGCCAACTTCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGA
HKR386484 RBd66D12 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR387769 RBd69H01 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR390146 RBd75G02 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR390175 RBd75H07 pGCAP10 NM_000971.2  
GGTCGCCGGCTCAGTTGGGGCGGAACACTTTGANCCTTTTCTTGGATGATGCTTGCTTCC
HKR394401 RBd86A01 pGCAP10 NM_000971.2  
GCTCTTTTTCCCCCTGGAACCATGGACGGTGTAGAAAACTGCCTCCCCGAGGTTCCCGCT
HKR394425 RBd86B01 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR395274 RBd88D02 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR396083 RBd90D11 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAACAAGAAGGAGGTTCCTGCT
HKR396827 RBd92B03 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR398026 RBd95B02 pGCAP10 NM_000971.2  
CGCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
HKR398806 RBd97A06 pGCAP10 NM_000971.2  
GCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
HKR398882 RBd97D10 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR402855 RBdS007C07 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR402899 RBdS007E03 pGCAP10 NM_000971.2  
TGCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR403178 RBdS007P18 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR405539 RBdS013O03 pGCAP10 NM_000971.2  
CCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR405560 RBdS013O24 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR405872 RBdS014L08 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR406237 RBdS015J21 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR408967 RBdS022G23 pGCAP10 NM_000971.2  
GCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGT
HKR416063 RBdS040C15 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR428012 RBdS070A12 pGCAP10 NM_000971.2  
CGGCCGGCCGATGAGTACGCATGCGCCAACTTCCTCTTTTTCCGGCTGGAACCATGGAGG
HKR430304 RBdS075M16 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR433449 RBdS083K09 pGCAP10 NM_000971.2  
GCCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTG
HKR441644 RBdS104B20 pGCAP10 NM_000971.2  
GTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTG
HKR442379 RBdS105P19 pGCAP10 NM_000971.2  
GGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGAAA
HKR444142 RBdS110F22 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR444344 RBdS110O08 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR452974 RBdS132H06 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR461728 RBdS154F08 pGCAP10 NM_000971.2  
GCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGA
HKR462405 RBdS156A05 pGCAP10 NM_000971.2  
GCCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGC
HKR462764 RBdS156P04 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
HKR475094 RBdS187M06 pGCAP10 NM_000971.2  
GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl