Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156P04

Clone ID RBdS156P04
HP ID HP00130
Gene ID 6129
Gene Symbol RPL7
Protein Name ribosomal protein L7
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000971.2
Length of RefSeq (bp) 838
Chromosome 8q13.3
Reference DDBJ accession
UniGene Hs.571841
5'-terminal sequence GCTCTTTTTCCGGCTGGAACCATGGAGGGTGTAGAAGAGAAGAAGAAGGAGGTTCCTGCT
2011.08.28