Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00113

HP ID(1) HP00113
Gene ID(2) 6176
Gene Symbol finder RPLP1
Protein Name ribosomal protein, large, P1
RefSeq NM_001003.2
Length of RefSeq (bp) 512
Chromosome 15q22
Reference DDBJ accession
UniGene Hs.356502

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01H11 pKA1U5 GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARe06C01 pKA1U5 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
ARe06G08 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe07B09 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe07C07 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe07E08 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe08C05 pKA1U5 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGATCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe08D07 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe08E09 pKA1U5 GCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe08E11 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe10B03 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe11E09 pKA1U5 ATCCTGGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTG
ARe12G06 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe13A04 pKA1U5 TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe15B05 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe16H02 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe19H11 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe26E09 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe26F02 pKA1U5 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
ARe29F03 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe29H01 pKA1U5 GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARe30C01 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe35G03 pKA1U5 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
ARe39C12 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe39D09 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe40D10 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe41H04 pKA1U5 GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARe44C11 pKA1U5 ACCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe45F07 pKA1U5 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGCTCCTTCCGAGGAAGCTAAGGCTGCG
ARe45H07 pKA1U5 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
ARe46F10 pKA1U5 GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe48A03 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTTGCTCGGTCCTTCCGAGGAAGCTAANGCTGCGGTT
ARe49C08 pKA1U5 GCTTTTCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
ARe52C11 pKA1U5 TTGCCTTTTCCTCATCTGCCGCCAAGGNGCTCGNNTCCTTCCGAGGAAGCTAAGGCTGCG
ARe52H02 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGATGCTCGGCCCTTTTAGAGGAAGCTAAGGCTGCGT
ARe53E08 pKA1U5 GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe55F08 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTNCGAGGAAGCTAAGGCTGCGTTGG
ARe56C01 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCNAGGAAGCTAAGGCTGCGTTGG
ARe60G04 pKA1U5 CCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe61B06 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGNCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe61G01 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe62C06 pKA1U5 TGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
ARe63F03 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe68G12 pKA1U5 TGGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
ARe70G12 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTNCGAGGAAGCTAAGGCTGCGTTGG
ARe75G08 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTTNNAGGAAGCTAAGGCTGCGTTGG
ARe79G09 pKA1U5 TAGGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
ARe79H03 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe80A08 pKA1U5 TCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe81F08 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe82H07 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe83B06 pKA1U5 ATCCTGGGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCT
ARe83G02 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGATCCTTCCGAGGAAGCTAAGGCTGCGTT
ARe87A12 pKA1U5 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
ARe90D09 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe91C03 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARe92A09 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARe99B03 pKA1U5 GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARf02A02 pKA1U5 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
ARf02D11 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARf03A04 pKA1U5 AGGCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARf07B06 pKA1U5 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
ARi02G12 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi04A01 pGCAP10 TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARi07F01 pGCAP10 TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARi10A12 pGCAP10 TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARi10C09 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi14H08 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi17B03 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi20A04 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi21B12 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi21D05 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi24E06 pGCAP10 GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGNAGCTAAGGCTGCGTT
ARi26G01 pGCAP10 CGGCCGGCCGATGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCT
ARi28C05 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi36G07 pGCAP10 GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARi37F10 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi39D11 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi39G10 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi44B05 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi44B06 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi51A09 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi53D06 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi54F04 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi56B01 pGCAP10 GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARi60C07 pGCAP10 AGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi60D02 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi61B07 pGCAP10 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
ARi62A03 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARi62A05 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARi71C05 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS008A16 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS020D06 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS020H04 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS020H11 pGCAP10 GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARiS020H19 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS020I24 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS020L03 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS023K02 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS045E22 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS045G23 pGCAP10 GCCTTCCGAGGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGC
ARiS045L09 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS049A17 pGCAP10 GCCTTTCCTCAGCTGCCCCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCNTTGG
ARiS049D01 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS049M21 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS055C09 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS055C13 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS055H17 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS085G16 pGCAP10 TGGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
ARiS085P10 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS087B11 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS087C05 pGCAP10 CCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS087C14 pGCAP10 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
ARiS087N12 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS088B08 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS088C07 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS096H06 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS118A01 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS118O11 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS118P15 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS122M21 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS150D07 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS150L09 pGCAP10 GCCTTCCGAGGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGC
ARiS191J20 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS194F13 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS194P10 pGCAP10 GCCTTCCNNNGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGC
ARiS198H09 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
ARiS198M15 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
ARiS198P10 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb04G08 pKA1U5 GCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb06C08 pKA1U5 CCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb06E02 pKA1U5 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb07E02 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb08C06 pKA1U5 GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb08F06 pKA1U5 CCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
RBb09E05 pKA1U5 TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBb11A12 pKA1U5 ATCCTGCCTTTCCTCAGCTGCCGCCAAGGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTG
RBb13A02 pKA1U5 GTGCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBb13G02 pKA1U5 ATCCTGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTTCCTTCCGAGGAAGCTAAGGCT
RBb15H11 pKA1U5 GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBb16D11 pKA1U5 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBb18A04 pKA1U5 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBb18H05 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb19C03 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb19D08 pKA1U5 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb23B08 pGCAP1 GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBb25F10 pGCAP1 TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb26H07 pGCAP1 GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBb27G09 pGCAP1 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb28A03 pGCAP1 GCCCTTCCGAGGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAG
RBb33F06 pGCAP1 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb38A03 pGCAP1 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb38B07 pGCAP1 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb42B10 pGCAP1 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
RBb45E06 pGCAP1 GAGCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBb48H09 pGCAP1 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb49A11 pGCAP1 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb50F05 pGCAP1 CCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb50F09 pGCAP1 TGCCCTTTCCTCAGCTGCCGCCAAGGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBb55B09 pGCAP1 TTTCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBb55F07 pGCAP1 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb58H07 pGCAP1 TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb59G05 pGCAP1 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb61A10 pGCAP1 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb66B06 pGCAP1 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb68H09 pGCAP1 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb71F02 pGCAP1 CCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBb72A09 pGCAP1 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBb72F12 pGCAP1 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd01G06 pGCAP10
RBd05A12 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd05G08 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd06F07 pGCAP10 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBd06H07 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd07C07 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd13B02 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd13H06 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd14B05 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd14C12 pGCAP10 TGCCTTTCCTCCACTGCCGCCGAGGTGCTCGGTCCTTCCTAGGAAGCTAAGGCTGCGTTG
RBd14F01 pGCAP10
RBd15D10 pGCAP10 TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBd16B03 pGCAP10 TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd17B11 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd18C02 pGCAP10
RBd21G11 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd22A07 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd25F12 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd27A07 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd27D09 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd27E02 pGCAP10 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
RBd28E12 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd29B07 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd29G09 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd34E10 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd35B01 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd36G05 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd37C12 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd38B12 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd42C12 pGCAP10 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBd42D04 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd44H03 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd44H09 pGCAP10 GAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGT
RBd44H11 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd45G01 pGCAP10 GCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd45G03 pGCAP10 TGGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBd46B02 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd48H12 pGCAP10 GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBd49E07 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd50A06 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGANCTNNGCTGCGTTGGGG
RBd50E07 pGCAP10 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBd51D02 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGGGCTCGGGCCTTCCGAAGAAGCTAGGGCTGCGTTG
RBd53G02 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAANNTAAGGCTGCGTTGG
RBd55F09 pGCAP10 TGCCTTTCCTCAGCTGCCGCCNAGGTGCTCGGTCCTTCCGANNNNNNTAAGGCTGCGTTG
RBd57E01 pGCAP10 TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd58E01 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd61H11 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd62A03 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd62B02 pGCAP10 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBd63C08 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd64E06 pGCAP10 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBd68A04 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd68A06 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd68G04 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd70H03 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd75E09 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd75G12 pGCAP10 CGGCCGGCCGATGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCT
RBd80A06 pGCAP10 GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBd80F06 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd80G04 pGCAP10 GTCGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
RBd81A05 pGCAP10 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
RBd88F10 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBd93B12 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd94C09 pGCAP10 GCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBd99G08 pGCAP10 GAGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
RBdS007E19 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS007G11 pGCAP10 GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
RBdS007H12 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS007I24 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS007O24 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS013P23 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS014K15 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS015G06 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS022F08 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS022K23 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS040J12 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS040L02 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS040P08 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS051B24 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS051C06 pGCAP10 GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
RBdS051C11 pGCAP10 GAGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
RBdS051C16 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS051G18 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS051N17 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS070K04 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS075E18 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS075L04 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS075L21 pGCAP10 GCCCTTTCCTCNGCTGCCNNCAAGGNGNNNGGNNGNTCCNAGGANNCTNNNGNTNNNNNN
RBdS075P13 pGCAP10 TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS081I01 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS083D04 pGCAP10 GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS083D19 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS104C10 pGCAP10 GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS104D17 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS104O22 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS104P03 pGCAP10 GCCTTTCCTTNCCTGCCACCNAGGTGCTCGGACCTTCCGANGAATCTAANGCNGCANNGN
RBdS105A05 pGCAP10
RBdS105A10 pGCAP10 CGGCCGGCCGATTGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAG
RBdS105B20 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS105L24 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS105M11 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS105P13 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS132C22 pGCAP10 GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
RBdS132L05 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS132M06 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS132M16 pGCAP10 GCCCTTTTCCTCAGCNGCCTCNNNGNNGCTNGGNCCTTNNNANGAANCTACCGNNGGGTC
RBdS132N14 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS132N19 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS132O22 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS132P16 pGCAP10 GCCNCNNCTCAGCTGCCCGNANGCCCTCGGCCCTTCCTAGGAANCTNANGCTGCGTAGGG
RBdS156F23 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS156H07 pGCAP10 CGGCCGGCCGATGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTA
RBdS156L16 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS177I03 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
RBdS177P07 pGCAP10 GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
RBdS187M23 pGCAP10 GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl