Prev. |  KEGG KO K02942 > 

RIKEN DNA Bank Human Resource - RPLP1

Gene ID NCBI Gene 6176 |  KEGG hsa:6176
Gene Symbol RPLP1
Protein Name ribosomal protein lateral stalk subunit P1
Synonyms LP1|P1|RPP1
Ortholog resources KEGG ortholog (KEGG orthology K02942) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001313 IRAK003E17 pCMV-SPORT6 BC003369 NM_213725 Full/var
HGY089018 IRAL022J02 pOTB7 BC007590 NM_001003 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040579 ARe01H11 pKA1U5 NM_001003.2  
GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR042449 ARe06C01 pKA1U5 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR042552 ARe06G08 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR042833 ARe07B09 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR042855 ARe07C07 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR042904 ARe07E08 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR043253 ARe08C05 pKA1U5 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGATCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR043279 ARe08D07 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR043305 ARe08E09 pKA1U5 NM_001003.2  
GCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR043307 ARe08E11 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR044027 ARe10B03 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR044505 ARe11E09 pKA1U5 NM_001003.2  
ATCCTGGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTG
HKR044950 ARe12G06 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR045204 ARe13A04 pKA1U5 NM_001003.2  
TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR046029 ARe15B05 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR046570 ARe16H02 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR047779 ARe19H11 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR050505 ARe26E09 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR050522 ARe26F02 pKA1U5 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR051723 ARe29F03 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR051769 ARe29H01 pKA1U5 NM_001003.2  
GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR052049 ARe30C01 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR054147 ARe35G03 pKA1U5 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR055660 ARe39C12 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR055681 ARe39D09 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR056082 ARe40D10 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR056572 ARe41H04 pKA1U5 NM_001003.2  
GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR057659 ARe44C11 pKA1U5 NM_001003.2  
ACCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR058127 ARe45F07 pKA1U5 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGCTCCTTCCGAGGAAGCTAAGGCTGCG
HKR058175 ARe45H07 pKA1U5 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR058530 ARe46F10 pKA1U5 NM_001003.2  
GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR059203 ARe48A03 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTTGCTCGGTCCTTCCGAGGAAGCTAANGCTGCGGTT
HKR059656 ARe49C08 pKA1U5 NM_001003.2  
GCTTTTCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR060859 ARe52C11 pKA1U5 NM_001003.2  
TTGCCTTTTCCTCATCTGCCGCCAAGGNGCTCGNNTCCTTCCGAGGAAGCTAAGGCTGCG
HKR060970 ARe52H02 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGATGCTCGGCCCTTTTAGAGGAAGCTAAGGCTGCGT
HKR061304 ARe53E08 pKA1U5 NM_001003.2  
GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR062128 ARe55F08 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTNCGAGGAAGCTAAGGCTGCGTTGG
HKR062449 ARe56C01 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCNAGGAAGCTAAGGCTGCGTTGG
HKR064148 ARe60G04 pKA1U5 NM_001003.2  
CCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR064430 ARe61B06 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGNCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR064545 ARe61G01 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR064854 ARe62C06 pKA1U5 NM_001003.2  
TGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR065323 ARe63F03 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR067356 ARe68G12 pKA1U5 NM_001003.2  
TGGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
HKR068156 ARe70G12 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTNCGAGGAAGCTAAGGCTGCGTTGG
HKR070152 ARe75G08 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTTNNAGGAAGCTAAGGCTGCGTTGG
HKR071753 ARe79G09 pKA1U5 NM_001003.2  
TAGGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
HKR071771 ARe79H03 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR072008 ARe80A08 pKA1U5 NM_001003.2  
TCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR072528 ARe81F08 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR072975 ARe82H07 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR073230 ARe83B06 pKA1U5 NM_001003.2  
ATCCTGGGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCT
HKR073346 ARe83G02 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGATCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR074812 ARe87A12 pKA1U5 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR076081 ARe90D09 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR076451 ARe91C03 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR076809 ARe92A09 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR079627 ARe99B03 pKA1U5 NM_001003.2  
GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR080802 ARf02A02 pKA1U5 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR080883 ARf02D11 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR081204 ARf03A04 pKA1U5 NM_001003.2  
AGGCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR082830 ARf07B06 pKA1U5 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR160956 ARi02G12 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR161601 ARi04A01 pGCAP10 NM_001003.2  
TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR162921 ARi07F01 pGCAP10 NM_001003.2  
TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR164012 ARi10A12 pGCAP10 NM_001003.2  
TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR164057 ARi10C09 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR165776 ARi14H08 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR166827 ARi17B03 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR168004 ARi20A04 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR168436 ARi21B12 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR168477 ARi21D05 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR169702 ARi24E06 pGCAP10 NM_001003.2  
GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGNAGCTAAGGCTGCGTT
HKR170545 ARi26G01 pGCAP10 NM_001003.2  
CGGCCGGCCGATGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCT
HKR171253 ARi28C05 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR174551 ARi36G07 pGCAP10 NM_001003.2  
GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR174930 ARi37F10 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR175683 ARi39D11 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR175754 ARi39G10 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR177629 ARi44B05 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR177630 ARi44B06 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR180409 ARi51A09 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR181278 ARi53D06 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR181724 ARi54F04 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR182425 ARi56B01 pGCAP10 NM_001003.2  
GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR184055 ARi60C07 pGCAP10 NM_001003.2  
AGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR184074 ARi60D02 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR184431 ARi61B07 pGCAP10 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR184803 ARi62A03 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR184805 ARi62A05 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR188453 ARi71C05 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR203216 ARiS008A16 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR208078 ARiS020D06 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR208172 ARiS020H04 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR208179 ARiS020H11 pGCAP10 NM_001003.2  
GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR208187 ARiS020H19 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR208216 ARiS020I24 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR208267 ARiS020L03 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR209442 ARiS023K02 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR218118 ARiS045E22 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR218167 ARiS045G23 pGCAP10 NM_001003.2  
GCCTTCCGAGGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGC
HKR218273 ARiS045L09 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR219617 ARiS049A17 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCCCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCNTTGG
HKR219673 ARiS049D01 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR219909 ARiS049M21 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR222057 ARiS055C09 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR222061 ARiS055C13 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR222185 ARiS055H17 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR234160 ARiS085G16 pGCAP10 NM_001003.2  
TGGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR234370 ARiS085P10 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR234835 ARiS087B11 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR234853 ARiS087C05 pGCAP10 NM_001003.2  
CCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR234862 ARiS087C14 pGCAP10 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR235124 ARiS087N12 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR235232 ARiS088B08 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR235255 ARiS088C07 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR238574 ARiS096H06 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR247201 ARiS118A01 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR247547 ARiS118O11 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR247575 ARiS118P15 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR249109 ARiS122M21 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR260079 ARiS150D07 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR260273 ARiS150L09 pGCAP10 NM_001003.2  
GCCTTCCGAGGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGC
HKR276636 ARiS191J20 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR277733 ARiS194F13 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR277970 ARiS194P10 pGCAP10 NM_001003.2  
GCCTTCCNNNGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAGC
HKR279377 ARiS198H09 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR279503 ARiS198M15 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR279570 ARiS198P10 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR321752 RBb04G08 pKA1U5 NM_001003.2  
GCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR322456 RBb06C08 pKA1U5 NM_001003.2  
CCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR322498 RBb06E02 pKA1U5 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR322898 RBb07E02 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR323254 RBb08C06 pKA1U5 NM_001003.2  
GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR323326 RBb08F06 pKA1U5 NM_001003.2  
CCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR323701 RBb09E05 pKA1U5 NM_001003.2  
TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR324412 RBb11A12 pKA1U5 NM_001003.2  
ATCCTGCCTTTCCTCAGCTGCCGCCAAGGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTG
HKR325202 RBb13A02 pKA1U5 NM_001003.2  
GTGCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR325346 RBb13G02 pKA1U5 NM_001003.2  
ATCCTGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTTCCTTCCGAGGAAGCTAAGGCT
HKR326179 RBb15H11 pKA1U5 NM_001003.2  
GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR326483 RBb16D11 pKA1U5 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR327204 RBb18A04 pKA1U5 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR327373 RBb18H05 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR327651 RBb19C03 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR327680 RBb19D08 pKA1U5 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR329232 RBb23B08 pGCAP1 NM_001003.2  
GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR330130 RBb25F10 pGCAP1 NM_001003.2  
TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR330575 RBb26H07 pGCAP1 NM_001003.2  
GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR330953 RBb27G09 pGCAP1 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR331203 RBb28A03 pGCAP1 NM_001003.2  
GCCCTTCCGAGGAAGCTAAGGCTGCGTTGGGGTGAGGCCCTCACTTCATCCGGCGACTAG
HKR333326 RBb33F06 pGCAP1 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR335203 RBb38A03 pGCAP1 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR335231 RBb38B07 pGCAP1 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR336834 RBb42B10 pGCAP1 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR338102 RBb45E06 pGCAP1 NM_001003.2  
GAGCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR339377 RBb48H09 pGCAP1 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR339611 RBb49A11 pGCAP1 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR340125 RBb50F05 pGCAP1 NM_001003.2  
CCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR340129 RBb50F09 pGCAP1 NM_001003.2  
TGCCCTTTCCTCAGCTGCCGCCAAGGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR342033 RBb55B09 pGCAP1 NM_001003.2  
TTTCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR342127 RBb55F07 pGCAP1 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR343375 RBb58H07 pGCAP1 NM_001003.2  
TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR343749 RBb59G05 pGCAP1 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR344410 RBb61A10 pGCAP1 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR346430 RBb66B06 pGCAP1 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR347377 RBb68H09 pGCAP1 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR348522 RBb71F02 pGCAP1 NM_001003.2  
CCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR348809 RBb72A09 pGCAP1 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR348932 RBb72F12 pGCAP1 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR360550 RBd01G06 pGCAP10 NM_001003.2  
HKR362012 RBd05A12 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR362152 RBd05G08 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR362527 RBd06F07 pGCAP10 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR362575 RBd06H07 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR362855 RBd07C07 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR365226 RBd13B02 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR365374 RBd13H06 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR365629 RBd14B05 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR365660 RBd14C12 pGCAP10 NM_001003.2  
TGCCTTTCCTCCACTGCCGCCGAGGTGCTCGGTCCTTCCTAGGAAGCTAAGGCTGCGTTG
HKR365721 RBd14F01 pGCAP10 NM_001003.2  
HKR366082 RBd15D10 pGCAP10 NM_001003.2  
TGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR366427 RBd16B03 pGCAP10 NM_001003.2  
TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR366835 RBd17B11 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR367250 RBd18C02 pGCAP10 NM_001003.2  
HKR368555 RBd21G11 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR368807 RBd22A07 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR370132 RBd25F12 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR370807 RBd27A07 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR370881 RBd27D09 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR370898 RBd27E02 pGCAP10 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR371308 RBd28E12 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR371631 RBd29B07 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR371753 RBd29G09 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR373706 RBd34E10 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR374025 RBd35B01 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR374549 RBd36G05 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR374860 RBd37C12 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR375236 RBd38B12 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR376860 RBd42C12 pGCAP10 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR376876 RBd42D04 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR377771 RBd44H03 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR377777 RBd44H09 pGCAP10 NM_001003.2  
GAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCCGTGCGCGTTGCTGCGGCCGT
HKR377779 RBd44H11 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR378145 RBd45G01 pGCAP10 NM_001003.2  
GCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR378147 RBd45G03 pGCAP10 NM_001003.2  
TGGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR378426 RBd46B02 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR379380 RBd48H12 pGCAP10 NM_001003.2  
GCCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR379703 RBd49E07 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR380006 RBd50A06 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGANCTNNGCTGCGTTGGGG
HKR380103 RBd50E07 pGCAP10 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR380474 RBd51D02 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGGGCTCGGGCCTTCCGAAGAAGCTAGGGCTGCGTTG
HKR381346 RBd53G02 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAANNTAAGGCTGCGTTGG
HKR382129 RBd55F09 pGCAP10 NM_001003.2  
TGCCTTTCCTCAGCTGCCGCCNAGGTGCTCGGTCCTTCCGANNNNNNTAAGGCTGCGTTG
HKR382897 RBd57E01 pGCAP10 NM_001003.2  
TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR383297 RBd58E01 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR384579 RBd61H11 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR384803 RBd62A03 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR384826 RBd62B02 pGCAP10 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR385256 RBd63C08 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR385702 RBd64E06 pGCAP10 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR387204 RBd68A04 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR387206 RBd68A06 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR387348 RBd68G04 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR388171 RBd70H03 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR390105 RBd75E09 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR390156 RBd75G12 pGCAP10 NM_001003.2  
CGGCCGGCCGATGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCT
HKR392006 RBd80A06 pGCAP10 NM_001003.2  
GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR392126 RBd80F06 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR392148 RBd80G04 pGCAP10 NM_001003.2  
GTCGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
HKR392405 RBd81A05 pGCAP10 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR395330 RBd88F10 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR397236 RBd93B12 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR397657 RBd94C09 pGCAP10 NM_001003.2  
GCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR399752 RBd99G08 pGCAP10 NM_001003.2  
GAGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
HKR402915 RBdS007E19 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR402955 RBdS007G11 pGCAP10 NM_001003.2  
GCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTT
HKR402980 RBdS007H12 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR403016 RBdS007I24 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR403160 RBdS007O24 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR405583 RBdS013P23 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR405855 RBdS014K15 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR406150 RBdS015G06 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR408928 RBdS022F08 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR409063 RBdS022K23 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR416228 RBdS040J12 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR416266 RBdS040L02 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR416368 RBdS040P08 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR420448 RBdS051B24 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR420454 RBdS051C06 pGCAP10 NM_001003.2  
GGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGT
HKR420459 RBdS051C11 pGCAP10 NM_001003.2  
GAGCCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCG
HKR420464 RBdS051C16 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR420562 RBdS051G18 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR420729 RBdS051N17 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR428244 RBdS070K04 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR430114 RBdS075E18 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR430268 RBdS075L04 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR430285 RBdS075L21 pGCAP10 NM_001003.2  
GCCCTTTCCTCNGCTGCCNNCAAGGNGNNNGGNNGNTCCNAGGANNCTNNNGNTNNNNNN
HKR430373 RBdS075P13 pGCAP10 NM_001003.2  
TGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR432593 RBdS081I01 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR433276 RBdS083D04 pGCAP10 NM_001003.2  
GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR433291 RBdS083D19 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR441658 RBdS104C10 pGCAP10 NM_001003.2  
GCCTTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR441689 RBdS104D17 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR441958 RBdS104O22 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR441963 RBdS104P03 pGCAP10 NM_001003.2  
GCCTTTCCTTNCCTGCCACCNAGGTGCTCGGACCTTCCGANGAATCTAANGCNGCANNGN
HKR442005 RBdS105A05 pGCAP10 NM_001003.2  
HKR442010 RBdS105A10 pGCAP10 NM_001003.2  
CGGCCGGCCGATTGCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAG
HKR442044 RBdS105B20 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR442288 RBdS105L24 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR442299 RBdS105M11 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR442373 RBdS105P13 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR452870 RBdS132C22 pGCAP10 NM_001003.2  
GCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGGG
HKR453069 RBdS132L05 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR453094 RBdS132M06 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR453104 RBdS132M16 pGCAP10 NM_001003.2  
GCCCTTTTCCTCAGCNGCCTCNNNGNNGCTNGGNCCTTNNNANGAANCTACCGNNGGGTC
HKR453126 RBdS132N14 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR453131 RBdS132N19 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR453158 RBdS132O22 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR453176 RBdS132P16 pGCAP10 NM_001003.2  
GCCNCNNCTCAGCTGCCCGNANGCCCTCGGCCCTTCCTAGGAANCTNANGCTGCGTAGGG
HKR462543 RBdS156F23 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR462575 RBdS156H07 pGCAP10 NM_001003.2  
CGGCCGGCCGATGCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTA
HKR462680 RBdS156L16 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR470995 RBdS177I03 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG
HKR471167 RBdS177P07 pGCAP10 NM_001003.2  
GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
HKR475111 RBdS187M23 pGCAP10 NM_001003.2  
GCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl