Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040L02

Clone ID RBdS040L02
HP ID HP00113
Gene ID 6176
Gene Symbol RPLP1
Protein Name ribosomal protein, large, P1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001003.2
Length of RefSeq (bp) 512
Chromosome 15q22
Reference DDBJ accession
UniGene Hs.356502
5'-terminal sequence GCCCTTTCCTCAGCTGCCGCCAAGGTGCTCGGTCCTTCCGAGGAAGCTAAGGCTGCGTTG
2011.08.28