Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00072

HP ID(1) HP00072
Gene ID(2) 6135
Gene Symbol finder RPL11
Protein Name ribosomal protein L11
RefSeq NM_000975.2
Length of RefSeq (bp) 609
Chromosome 1p36.1-p35
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06E03 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe12D03 pKA1U5 CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
ARe16C12 pKA1U5 CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
ARe21G12 pKA1U5 GGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCA
ARe31H11 pKA1U5 ATCCTGTTTTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCC
ARe35E01 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe37B01 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe50G01 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe54B12 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe56E10 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGCGAAAAGGAGAACCCCATGCGGGAACT
ARe58E12 pKA1U5 CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
ARe67B06 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe73A07 pKA1U5 CTCTTCCTGCTCTCCATCATGGCGCAGGATCAANGTGAAAAGGAGAACCCCATGCGGGAA
ARe73B01 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCANGGTGAAAAGGAGAACCCCATGCGGGA
ARe81A01 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe85E11 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe89D11 pKA1U5 ATCCTGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATG
ARe92B06 pKA1U5 CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
ARe92C04 pKA1U5 ATCCTGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATG
ARe93G03 pKA1U5 GCTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGG
ARe96G07 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARe99F11 pKA1U5 GCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCA
ARf06F12 pKA1U5 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi03D09 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi05E09 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi11G06 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi12E01 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi29A11 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi29E03 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi31D11 pGCAP10 TCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi36B03 pGCAP10 GCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCG
ARi38F06 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi42H06 pGCAP10 GCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCG
ARi46D02 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi47G06 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
ARi51D03 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
ARi55B11 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi58B10 pGCAP10 GCTCTCTTCCTGCTCTCCATCATGGCGCNNGATCAAGGTGAAAAGGAGAACCCCATGCGG
ARi61D03 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi63C05 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARi65H09 pGCAP10 GCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAAC
ARi66A09 pGCAP10 TGGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGG
ARi71C02 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARiS008B07 pGCAP10 GGGAAGCTCCGCTTTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAG
ARiS013A12 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
ARiS013K21 pGCAP10 GTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGG
ARiS020I08 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARiS055P01 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARiS085B07 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARiS085J20 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARiS088N24 pGCAP10 CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
ARiS088P15 pGCAP10 GCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTC
ARiS109G12 pGCAP10 CCGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGG
ARiS161E08 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
ARiS194F11 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
ARiS198I21 pGCAP10
RBb11H08 pKA1U5 CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
RBb64G12 pGCAP1 CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
RBb68B11 pGCAP1 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd04E10 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd06C10 pGCAP10 GCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCG
RBd11B09 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd15D01 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd15E07 pGCAP10 TGGCTCTTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATG
RBd19D11 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd20B02 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd24A11 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd26B12 pGCAP10 GCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCG
RBd27F03 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd28G01 pGCAP10 GGCTTTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATG
RBd37G04 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd43C12 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
RBd48C04 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd48D10 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd52F12 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
RBd65A02 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd82G08 pGCAP10 TTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
RBd83E07 pGCAP10 AAAGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCG
RBd83H06 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
RBd86A04 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd87C03 pGCAP10 ACTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd87E11 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBd98D12 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS013B09 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS013D11 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS014O22 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS015K08 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS040M04 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
RBdS051F18 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS083C07 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS104H07 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS105G12 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS177C16 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
RBdS177M15 pGCAP10 GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl