Prev. |  KEGG KO K02868 > 

RIKEN DNA Bank Human Resource - RPL11

Gene ID NCBI Gene 6135 |  KEGG hsa:6135
Gene Symbol RPL11
Protein Name ribosomal protein L11
Synonyms DBA7|GIG34|L11|uL5
Ortholog resources KEGG ortholog (KEGG orthology K02868) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17330 pFLAG-CMV-5a-RPL11 Expression vector of human RPL11 tagged with FLAG at C-terminus.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091168 IRAL027P08 pOTB7 BC018970 NM_000975 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042499 ARe06E03 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR044875 ARe12D03 pKA1U5 NM_000975.2  
CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
HKR046460 ARe16C12 pKA1U5 NM_000975.2  
CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
HKR048556 ARe21G12 pKA1U5 NM_000975.2  
GGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCA
HKR052579 ARe31H11 pKA1U5 NM_000975.2  
ATCCTGTTTTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCC
HKR054097 ARe35E01 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR054825 ARe37B01 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR060145 ARe50G01 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR061636 ARe54B12 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR062506 ARe56E10 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGCGAAAAGGAGAACCCCATGCGGGAACT
HKR063308 ARe58E12 pKA1U5 NM_000975.2  
CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
HKR066830 ARe67B06 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR069207 ARe73A07 pKA1U5 NM_000975.2  
CTCTTCCTGCTCTCCATCATGGCGCAGGATCAANGTGAAAAGGAGAACCCCATGCGGGAA
HKR069225 ARe73B01 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCANGGTGAAAAGGAGAACCCCATGCGGGA
HKR072401 ARe81A01 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR074107 ARe85E11 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR075683 ARe89D11 pKA1U5 NM_000975.2  
ATCCTGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATG
HKR076830 ARe92B06 pKA1U5 NM_000975.2  
CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
HKR076852 ARe92C04 pKA1U5 NM_000975.2  
ATCCTGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATG
HKR077347 ARe93G03 pKA1U5 NM_000975.2  
GCTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGG
HKR078551 ARe96G07 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR079731 ARe99F11 pKA1U5 NM_000975.2  
GCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCA
HKR082532 ARf06F12 pKA1U5 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR161281 ARi03D09 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR162105 ARi05E09 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR164550 ARi11G06 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR164897 ARi12E01 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR171611 ARi29A11 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR171699 ARi29E03 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR172483 ARi31D11 pGCAP10 NM_000975.2  
TCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR174427 ARi36B03 pGCAP10 NM_000975.2  
GCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCG
HKR175326 ARi38F06 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR176974 ARi42H06 pGCAP10 NM_000975.2  
GCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCG
HKR178474 ARi46D02 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR178950 ARi47G06 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
HKR180475 ARi51D03 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
HKR182035 ARi55B11 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR183234 ARi58B10 pGCAP10 NM_000975.2  
GCTCTCTTCCTGCTCTCCATCATGGCGCNNGATCAAGGTGAAAAGGAGAACCCCATGCGG
HKR184475 ARi61D03 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR185253 ARi63C05 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR186177 ARi65H09 pGCAP10 NM_000975.2  
GCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAAC
HKR186409 ARi66A09 pGCAP10 NM_000975.2  
TGGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGG
HKR188450 ARi71C02 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR203231 ARiS008B07 pGCAP10 NM_000975.2  
GGGAAGCTCCGCTTTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAG
HKR205212 ARiS013A12 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
HKR205461 ARiS013K21 pGCAP10 NM_000975.2  
GTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGG
HKR208200 ARiS020I08 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR222361 ARiS055P01 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR234031 ARiS085B07 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR234236 ARiS085J20 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR235536 ARiS088N24 pGCAP10 NM_000975.2  
CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
HKR235575 ARiS088P15 pGCAP10 NM_000975.2  
GCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTC
HKR243756 ARiS109G12 pGCAP10 NM_000975.2  
CCGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGG
HKR264504 ARiS161E08 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
HKR277731 ARiS194F11 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR279413 ARiS198I21 pGCAP10 NM_000975.2  
HKR324576 RBb11H08 pKA1U5 NM_000975.2  
CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
HKR345756 RBb64G12 pGCAP1 NM_000975.2  
CTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
HKR347235 RBb68B11 pGCAP1 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR361706 RBd04E10 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR362458 RBd06C10 pGCAP10 NM_000975.2  
GCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCG
HKR364433 RBd11B09 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR366073 RBd15D01 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR366103 RBd15E07 pGCAP10 NM_000975.2  
TGGCTCTTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATG
HKR367683 RBd19D11 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR368026 RBd20B02 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR369611 RBd24A11 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR370436 RBd26B12 pGCAP10 NM_000975.2  
GCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCG
HKR370923 RBd27F03 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR371345 RBd28G01 pGCAP10 NM_000975.2  
GGCTTTCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATG
HKR374948 RBd37G04 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR377260 RBd43C12 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
HKR379252 RBd48C04 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR379282 RBd48D10 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR380932 RBd52F12 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
HKR386002 RBd65A02 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR392952 RBd82G08 pGCAP10 NM_000975.2  
TTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAA
HKR393303 RBd83E07 pGCAP10 NM_000975.2  
AAAGCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCG
HKR393374 RBd83H06 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
HKR394404 RBd86A04 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR394851 RBd87C03 pGCAP10 NM_000975.2  
ACTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR394907 RBd87E11 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR399284 RBd98D12 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR405233 RBdS013B09 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR405283 RBdS013D11 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR405958 RBdS014O22 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR406248 RBdS015K08 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR416292 RBdS040M04 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACT
HKR420538 RBdS051F18 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR433255 RBdS083C07 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR441775 RBdS104H07 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR442156 RBdS105G12 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR470864 RBdS177C16 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
HKR471103 RBdS177M15 pGCAP10 NM_000975.2  
GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.10.26

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl