Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014O22

Clone ID RBdS014O22
HP ID HP00072
Gene ID 6135
Gene Symbol RPL11
Protein Name ribosomal protein L11
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000975.2
Length of RefSeq (bp) 609
Chromosome 1p36.1-p35
Reference DDBJ accession
UniGene
5'-terminal sequence GCTCTTCCTGCTCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGA
2011.08.28