Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00063

HP ID(1) HP00063
Gene ID(2) 6168
Gene Symbol finder RPL37A
Protein Name ribosomal protein L37a
RefSeq NM_000998.4
Length of RefSeq (bp) 434
Chromosome 2q35
Reference DDBJ accession
UniGene Hs.433701

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04F04 pKA1U5 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACCCTTTTCAAACGTACCAAGAAAGTCGG
ARe06H05 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe20G07 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACCTGGCCAAACGTACCAAGAAAGTCGGGA
ARe28C01 pKA1U5 TGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARe32D10 pKA1U5 CCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe36C03 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe37B08 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe40B10 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe44B04 pKA1U5 ATCCTGGCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAA
ARe48A04 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe50F10 pKA1U5 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARe50H07 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe52F02 pKA1U5 GCTTNCTGGGCTCNNACCTAGGATCGCGGCGACNCCTTTTAAACGTTACCTAGAAAAGTC
ARe53A09 pKA1U5 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARe56E06 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACCNGGTNCAAACGTACCAAGAAAGTCGGG
ARe65C04 pKA1U5 ATCCTGCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAG
ARe68H08 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe69E11 pKA1U5 GCTTTTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
ARe80H01 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe86H11 pKA1U5 GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
ARe88B10 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe89G06 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe90D01 pKA1U5 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARe95C01 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARe98D11 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARf02B11 pKA1U5 CTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARf03E05 pKA1U5 GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
ARf04H09 pKA1U5 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARi01D12 pGCAP10 GTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCATACGTACCAAGAAAGT
ARi02H12 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARi15A06 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARi16C06 pGCAP10 TGGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
ARi19D11 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARi19G11 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACTGGCCAAACGTACCAAGAAAGTCGGGAT
ARi30C02 pGCAP10 CGGCCGGCCGATGTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTAC
ARi34F02 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARi39A06 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARi39A09 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARi39G01 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARi47A05 pGCAP10 TGGCTGGCGGTGCCTGGACGTACAATACCACTTCCGCTGTCACGGTAAAGTCCGCCATCA
ARi47F07 pGCAP10 GCTTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
ARi49A07 pGCAP10 TCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARi50H06 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARi51C12 pGCAP10 GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
ARi52B11 pGCAP10 GCTTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAA
ARi52E04 pGCAP10 GCTTTTTTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAG
ARi55C09 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARi55E06 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARi55E12 pGCAP10 GGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGATCGTCG
ARi67H08 pGCAP10 GCTTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
ARi71A11 pGCAP10 GGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCA
ARi71G03 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS008B16 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS020F03 pGCAP10 GGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCA
ARiS020N16 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS023I05 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS045J22 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
ARiS055D08 pGCAP10 CGGCCGGCCGATGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCA
ARiS055N18 pGCAP10 GTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAA
ARiS085H11 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS088D17 pGCAP10 GGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGATCGTCGGT
ARiS088M22 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS088N21 pGCAP10
ARiS109O04 pGCAP10 GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGTCTATCACTGGTTTCTCCCT
ARiS122E23 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS150J19 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS161F03 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS191M08 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
ARiS198O19 pGCAP10
RBb04D03 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBb11E02 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBb19A07 pKA1U5 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBb26D11 pGCAP1 TGCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
RBb27F02 pGCAP1 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBb35E11 pGCAP1 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBb39B04 pGCAP1 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTTACCAAGAAAGTCGGG
RBb46G03 pGCAP1 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBb54C12 pGCAP1 GTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
RBb54D12 pGCAP1 GTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
RBb54F02 pGCAP1 GCTTTCTGGGCTCGGACCTAGGTTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBb55G05 pGCAP1 TGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBb58D03 pGCAP1 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTTACCAAGAAAGTCGG
RBd06F04 pGCAP10 GGCCTGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATG
RBd20B03 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBd23C12 pGCAP10 ACCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBd24G05 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd30G04 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd37C05 pGCAP10 TCTGCTTTCTGGGCTCGGACCTTTGTCGCGGCGACATGCGCCATCATACCCAGAAGGACG
RBd43G12 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd48B08 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd50H10 pGCAP10 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBd52G01 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBd54H12 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd58G02 pGCAP10 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBd59G04 pGCAP10 GTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGAT
RBd63H01 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBd70C08 pGCAP10 GAATACCGCGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGA
RBd71C11 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd72B05 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd78H10 pGCAP10 GCTAATACCGCGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGC
RBd79F08 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd85D12 pGCAP10 GCCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
RBd92C09 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBd93A08 pGCAP10 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBd99E02 pGCAP10 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBd99F09 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS015G15 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS022D20 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS022O18 pGCAP10 GCTTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
RBdS040A07 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS040E23 pGCAP10 GTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
RBdS051F21 pGCAP10 GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
RBdS051O08 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS070K17 pGCAP10 GTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
RBdS075B03 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS075F02 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS075P15 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS081B21 pGCAP10 TGGTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGATCGTCGGT
RBdS081E12 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS083D10 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS104I21 pGCAP10 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS104N21 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS105C17 pGCAP10 TGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGNA
RBdS110C20 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS110I11 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS110N16 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS132I12 pGCAP10 TGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS132P10 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS156I13 pGCAP10 GCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGATCGT
RBdS156I16 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS156M01 pGCAP10 GCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAG
RBdS156O22 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS156P15 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS177O04 pGCAP10 GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
RBdS177D05 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS177F24 pGCAP10 GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
RBdS187F07 pGCAP10 GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl