Prev. |  KEGG KO K02921 > 

RIKEN DNA Bank Human Resource - RPL37A

Gene ID NCBI Gene 6168 |  KEGG hsa:6168
Gene Symbol RPL37A
Protein Name ribosomal protein L37a
Synonyms L37A
Ortholog resources KEGG ortholog (KEGG orthology K02921) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013841 IRAK034K01 pBluescriptR BC016748 NM_000998 Full
HGX054222 IRAK135J06 pCMV-SPORT6 BC063476 NM_000998 Partial/var
HGY082145 IRAL005G01 pOTB7 BC000555 NM_000998 Partial
HGY093405 IRAL033I13 pOTB7 BC014262 NM_000998 Full
HGY103677 IRAL059D05 pOTB7 BC082239 NM_000998 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100430 M01C051B06 pDONR221 MGC15-D03 BC014262 NM_000998  
HGE100478 M01C051D06 pDONR221 MGC15-D03 BC014262 NM_000998  
HGE100526 M01C051F06 pDONR221 MGC15-D03 BC014262 NM_000998  
HGE100574 M01C051H06 pDONR221 MGC15-D03 BC014262 NM_000998  
HGE100622 M01C051J06 pDONR221 MGC15-D03 BC014262 NM_000998  
HGE100670 M01C051L06 pDONR221 MGC15-D03 BC014262 NM_000998  
HGE100718 M01C051N06 pDONR221 MGC15-D03 BC014262 NM_000998  
HGE100766 M01C051P06 pDONR221 MGC15-D03 BC014262 NM_000998  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041724 ARe04F04 pKA1U5 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACCCTTTTCAAACGTACCAAGAAAGTCGG
HKR042573 ARe06H05 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR048151 ARe20G07 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACCTGGCCAAACGTACCAAGAAAGTCGGGA
HKR051249 ARe28C01 pKA1U5 NM_000998.4  
TGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR052882 ARe32D10 pKA1U5 NM_000998.4  
CCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR054451 ARe36C03 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR054832 ARe37B08 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR056034 ARe40B10 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR057628 ARe44B04 pKA1U5 NM_000998.4  
ATCCTGGCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAA
HKR059204 ARe48A04 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR060130 ARe50F10 pKA1U5 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR060175 ARe50H07 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR060922 ARe52F02 pKA1U5 NM_000998.4  
GCTTNCTGGGCTCNNACCTAGGATCGCGGCGACNCCTTTTAAACGTTACCTAGAAAAGTC
HKR061209 ARe53A09 pKA1U5 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR062502 ARe56E06 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACCNGGTNCAAACGTACCAAGAAAGTCGGG
HKR066052 ARe65C04 pKA1U5 NM_000998.4  
ATCCTGCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAG
HKR067376 ARe68H08 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR067707 ARe69E11 pKA1U5 NM_000998.4  
GCTTTTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
HKR072169 ARe80H01 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR074579 ARe86H11 pKA1U5 NM_000998.4  
GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
HKR075234 ARe88B10 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR075750 ARe89G06 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR076073 ARe90D01 pKA1U5 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR078049 ARe95C01 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR079283 ARe98D11 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR080835 ARf02B11 pKA1U5 NM_000998.4  
CTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR081301 ARf03E05 pKA1U5 NM_000998.4  
GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
HKR081777 ARf04H09 pKA1U5 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR160484 ARi01D12 pGCAP10 NM_000998.4  
GTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCATACGTACCAAGAAAGT
HKR160980 ARi02H12 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR166006 ARi15A06 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR166454 ARi16C06 pGCAP10 NM_000998.4  
TGGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
HKR167683 ARi19D11 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR167755 ARi19G11 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACTGGCCAAACGTACCAAGAAAGTCGGGAT
HKR172050 ARi30C02 pGCAP10 NM_000998.4  
CGGCCGGCCGATGTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTAC
HKR173722 ARi34F02 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR175606 ARi39A06 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR175609 ARi39A09 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR175745 ARi39G01 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR178805 ARi47A05 pGCAP10 NM_000998.4  
TGGCTGGCGGTGCCTGGACGTACAATACCACTTCCGCTGTCACGGTAAAGTCCGCCATCA
HKR178927 ARi47F07 pGCAP10 NM_000998.4  
GCTTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
HKR179607 ARi49A07 pGCAP10 NM_000998.4  
TCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR180174 ARi50H06 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR180460 ARi51C12 pGCAP10 NM_000998.4  
GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
HKR180835 ARi52B11 pGCAP10 NM_000998.4  
GCTTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAA
HKR180900 ARi52E04 pGCAP10 NM_000998.4  
GCTTTTTTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAG
HKR182057 ARi55C09 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR182102 ARi55E06 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR182108 ARi55E12 pGCAP10 NM_000998.4  
GGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGATCGTCG
HKR186976 ARi67H08 pGCAP10 NM_000998.4  
GCTTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
HKR188411 ARi71A11 pGCAP10 NM_000998.4  
GGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCA
HKR188547 ARi71G03 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR203240 ARiS008B16 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR208123 ARiS020F03 pGCAP10 NM_000998.4  
GGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCA
HKR208328 ARiS020N16 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR209397 ARiS023I05 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR218238 ARiS045J22 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR222080 ARiS055D08 pGCAP10 NM_000998.4  
CGGCCGGCCGATGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCA
HKR222330 ARiS055N18 pGCAP10 NM_000998.4  
GTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAA
HKR234179 ARiS085H11 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR235289 ARiS088D17 pGCAP10 NM_000998.4  
GGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGATCGTCGGT
HKR235510 ARiS088M22 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR235533 ARiS088N21 pGCAP10 NM_000998.4  
HKR243940 ARiS109O04 pGCAP10 NM_000998.4  
GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGTCTATCACTGGTTTCTCCCT
HKR248919 ARiS122E23 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR260235 ARiS150J19 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR264523 ARiS161F03 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR276696 ARiS191M08 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR279555 ARiS198O19 pGCAP10 NM_000998.4  
HKR321675 RBb04D03 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR324498 RBb11E02 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR327607 RBb19A07 pKA1U5 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR330483 RBb26D11 pGCAP1 NM_000998.4  
TGCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
HKR330922 RBb27F02 pGCAP1 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR334107 RBb35E11 pGCAP1 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR335628 RBb39B04 pGCAP1 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTTACCAAGAAAGTCGGG
HKR338547 RBb46G03 pGCAP1 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR341660 RBb54C12 pGCAP1 NM_000998.4  
GTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
HKR341684 RBb54D12 pGCAP1 NM_000998.4  
GTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
HKR341722 RBb54F02 pGCAP1 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR342149 RBb55G05 pGCAP1 NM_000998.4  
TGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR343275 RBb58D03 pGCAP1 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTTACCAAGAAAGTCGG
HKR362524 RBd06F04 pGCAP10 NM_000998.4  
GGCCTGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATG
HKR368027 RBd20B03 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR369260 RBd23C12 pGCAP10 NM_000998.4  
ACCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR369749 RBd24G05 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR372148 RBd30G04 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR374853 RBd37C05 pGCAP10 NM_000998.4  
TCTGCTTTCTGGGCTCGGACCTTTGTCGCGGCGACATGCGCCATCATACCCAGAAGGACG
HKR377356 RBd43G12 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR379232 RBd48B08 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR380178 RBd50H10 pGCAP10 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR380945 RBd52G01 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR381780 RBd54H12 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR383346 RBd58G02 pGCAP10 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR383748 RBd59G04 pGCAP10 NM_000998.4  
GTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGAT
HKR385369 RBd63H01 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR388056 RBd70C08 pGCAP10 NM_000998.4  
GAATACCGCGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGA
HKR388459 RBd71C11 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR388829 RBd72B05 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR391378 RBd78H10 pGCAP10 NM_000998.4  
GCTAATACCGCGCCTGCGCACCGCGTCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGC
HKR391728 RBd79F08 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR394084 RBd85D12 pGCAP10 NM_000998.4  
GCCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
HKR396857 RBd92C09 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR397208 RBd93A08 pGCAP10 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR399698 RBd99E02 pGCAP10 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR399729 RBd99F09 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR406159 RBdS015G15 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR408892 RBdS022D20 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR409154 RBdS022O18 pGCAP10 NM_000998.4  
GCTTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
HKR416007 RBdS040A07 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR416119 RBdS040E23 pGCAP10 NM_000998.4  
GTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGG
HKR420541 RBdS051F21 pGCAP10 NM_000998.4  
GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
HKR420744 RBdS051O08 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR428257 RBdS070K17 pGCAP10 NM_000998.4  
GTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGT
HKR430027 RBdS075B03 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR430122 RBdS075F02 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR430375 RBdS075P15 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR432445 RBdS081B21 pGCAP10 NM_000998.4  
TGGTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGATCGTCGGT
HKR432508 RBdS081E12 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR433282 RBdS083D10 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR441813 RBdS104I21 pGCAP10 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR441933 RBdS104N21 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR442065 RBdS105C17 pGCAP10 NM_000998.4  
TGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGNA
HKR444068 RBdS110C20 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR444203 RBdS110I11 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR444328 RBdS110N16 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR453004 RBdS132I12 pGCAP10 NM_000998.4  
TGCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR453170 RBdS132P10 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR462605 RBdS156I13 pGCAP10 NM_000998.4  
GCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGATCGT
HKR462608 RBdS156I16 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR462689 RBdS156M01 pGCAP10 NM_000998.4  
GCTCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAG
HKR462758 RBdS156O22 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR462775 RBdS156P15 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR470877 RBdS177D05 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR470944 RBdS177F24 pGCAP10 NM_000998.4  
GCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGGA
HKR471140 RBdS177O04 pGCAP10 NM_000998.4  
GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
HKR474927 RBdS187F07 pGCAP10 NM_000998.4  
GCTTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl