Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104I21

Clone ID RBdS104I21
HP ID HP00063
Gene ID 6168
Gene Symbol RPL37A
Protein Name ribosomal protein L37a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000998.4
Length of RefSeq (bp) 434
Chromosome 2q35
Reference DDBJ accession
UniGene Hs.433701
5'-terminal sequence GCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTCGGG
2011.08.28