Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00050

HP ID(1) HP00050
Gene ID(2) 6167
Gene Symbol finder RPL37
Protein Name ribosomal protein L37
RefSeq NM_000997.4
Length of RefSeq (bp) 1586
Chromosome 5p13
Reference DDBJ accession
UniGene Hs.80545

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05D10 pKA1U5 ATCCTGAAAGCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAA
ARe11B10 pKA1U5 TGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
ARe12C08 pKA1U5 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
ARe12F10 pKA1U5 ATCCTGTGGCTCTTCCGGTCTTTCTGGTCTCGNCCGCAGAAGCGAGATGACGAAGGGAAC
ARe14H05 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe18C08 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe27H12 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe35C07 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe35G08 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe37A09 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGGTTTGGAAAGC
ARe46F09 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe53H01 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe55C08 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACCAANGGAACGTCATCGTTTTGGAAAGC
ARe58D12 pKA1U5 ATCCTGGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGG
ARe66B10 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe68B08 pKA1U5 AGCTTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCA
ARe68F02 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe70F01 pKA1U5 GTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGANATGACGAAGGGAACGTCATCGTT
ARe73A02 pKA1U5 GCTTTCTGGTCTCNGNCGCANAAAGCTAGATGACCAANGGAACGTCTTCGGTTTGGAAAG
ARe73A06 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACCAANGGAACGTCATCGTTTGGAAAGCG
ARe78H04 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe79D10 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe80C11 pKA1U5 GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
ARe81G02 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe81G09 pKA1U5 ATCCTGGTGGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATA
ARe86E04 pKA1U5 TGGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
ARe87D12 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARe93H11 pKA1U5 TGGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACNAAGGGAACGTCATCGTTTGGAAAG
ARi11A02 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
ARi11G08 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi13C06 pGCAP10 GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
ARi13G06 pGCAP10 GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
ARi14F04 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi16F08 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi17C04 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi20B10 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
ARi23D07 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi23F09 pGCAP10 GAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACAC
ARi28G07 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi30B01 pGCAP10 GCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCA
ARi41B02 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi43A06 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi43C02 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi46H03 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi50B06 pGCAP10 GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
ARi58E05 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARi67G01 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS020E20 pGCAP10 TAATGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAA
ARiS020O14 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS045C15 pGCAP10 GCTTTCTGGTCTCGGCCGCANAANCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS045K20 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS045N15 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS049F17 pGCAP10 GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
ARiS055M11 pGCAP10 GCTTTTTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGG
ARiS055O10 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS085I10 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
ARiS085L06 pGCAP10 GCTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATC
ARiS087F03 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS096D02 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS096O18 pGCAP10 TGCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCG
ARiS118A06 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS118J07 pGCAP10 GCTTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCAT
ARiS118P18 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS122M02 pGCAP10 CGGCCGGCCGATGCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGG
ARiS150C24 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS150E06 pGCAP10 GCTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATC
ARiS150M04 pGCAP10 GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
ARiS191A07 pGCAP10 GGTNTNTGGTCTCNGCCGGNNACNCGAGNNGACCAAGGGAACGTCNTCGTTTGGAAAGCG
ARiS191C05 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS191F17 pGCAP10 GTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
ARiS191F24 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
ARiS191I19 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBb03D11 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBb04E02 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBb08A12 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBb17A07 pKA1U5 GCTTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCAT
RBb18B05 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBb20C10 pKA1U5 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBb24B04 pGCAP1 GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
RBb30H08 pGCAP1 GTGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
RBb31F03 pGCAP1
RBb36C10 pGCAP1 GGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCAC
RBb43H07 pGCAP1 GAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACACGT
RBb46F12 pGCAP1 GCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCA
RBb68D05 pGCAP1 GCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCA
RBb68H11 pGCAP1 CTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGT
RBb69G07 pGCAP1 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBb71H10 pGCAP1 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd03E06 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd04C07 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd12C06 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
RBd12D06 pGCAP10 GAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACAC
RBd15A10 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
RBd16H04 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd18F12 pGCAP10 GTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGT
RBd21A10 pGCAP10 TGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
RBd26H01 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd29E03 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd37B08 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd41G03 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd42A07 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd43C10 pGCAP10 GTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCG
RBd43D10 pGCAP10
RBd47G01 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd50C10 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd58C11 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTNATCGTTTGGAAAGCG
RBd61A05 pGCAP10 GGACGGGACGCGGCTCCGGGAACATGGCTCGCTTCGCTCTGACTGTTGTCCGGCATGGAG
RBd61A07 pGCAP10 GCTTTCTGGTCTCGGCCGCACAANATNGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd64H10 pGCAP10 GCTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
RBd65D04 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd66G10 pGCAP10 GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
RBd67G10 pGCAP10 GAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACAC
RBd68E05 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd71E10 pGCAP10 GTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd74D03 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd74E09 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd75A07 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
RBd77C02 pGCAP10 GCTTTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAA
RBd79G08 pGCAP10 GNTTTCTGNNCTCGGCCGCANAAGCGAGATGACAAAGGGAACGTCNTCGTTTGGAAAGNG
RBd85H08 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBd91E06 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
RBd98G01 pGCAP10 GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
RBd99A07 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
RBd99H09 pGCAP10 TGCTTTTCTGGTCCCGCCCTGCTAGCCGATATGACGAACGGAANNCNATCGTTGGGAAAN
RBdS013C17 pGCAP10 GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
RBdS013J04 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBdS014C23 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBdS014F15 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBdS022P12 pGCAP10 GCTTTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAA
RBdS051D14 pGCAP10 GCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGC
RBdS070A11 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBdS070J06 pGCAP10 GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
RBdS075G06 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBdS081O06 pGCAP10 GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
RBdS105G23 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBdS110C09 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBdS110E08 pGCAP10 TGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
RBdS132C18 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
RBdS132H18 pGCAP10 GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
RBdS154E18 pGCAP10 TGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
RBdS177D04 pGCAP10 GAGTNGCTTTCTGGTCTCNGCCGCANAANCNAGATGACGAAGGGAACGTCNTCGTTTGGA
RBdS177F04 pGCAP10 GCTTTCTGGTCTCGGCCGCANAAGCGAGATGACNAANGGAACGTCATCGTTTGGAAAGCG
RBdS187P06 pGCAP10 GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl