Prev. |  KEGG KO K02922 > 

RIKEN DNA Bank Human Resource - RPL37

Gene ID NCBI Gene 6167 |  KEGG hsa:6167
Gene Symbol RPL37
Protein Name ribosomal protein L37
Synonyms L37
Ortholog resources KEGG ortholog (KEGG orthology K02922) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067388 IRAK168H20 pBluescriptR BC067790 NM_000997 Full/var
HGY102969 IRAL057H01 pDNR-LIB BC070206 NM_000997.5 Partial
HGY103601 IRAL059A01 pOTB7 BC079477 NM_000997 Full
HGY103974 IRAL059P14 pOTB7 BC084576 NM_000997 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042082 ARe05D10 pKA1U5 NM_000997.4  
ATCCTGAAAGCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAA
HKR044434 ARe11B10 pKA1U5 NM_000997.4  
TGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR044856 ARe12C08 pKA1U5 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR044930 ARe12F10 pKA1U5 NM_000997.4  
ATCCTGTGGCTCTTCCGGTCTTTCTGGTCTCGNCCGCAGAAGCGAGATGACGAAGGGAAC
HKR045773 ARe14H05 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR047256 ARe18C08 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR050980 ARe27H12 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR054055 ARe35C07 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR054152 ARe35G08 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR054809 ARe37A09 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGGTTTGGAAAGC
HKR058529 ARe46F09 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR061369 ARe53H01 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR062056 ARe55C08 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACCAANGGAACGTCATCGTTTTGGAAAGC
HKR063284 ARe58D12 pKA1U5 NM_000997.4  
ATCCTGGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGG
HKR066434 ARe66B10 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR067232 ARe68B08 pKA1U5 NM_000997.4  
AGCTTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCA
HKR067322 ARe68F02 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR068121 ARe70F01 pKA1U5 NM_000997.4  
GTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGANATGACGAAGGGAACGTCATCGTT
HKR069202 ARe73A02 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCNGNCGCANAAAGCTAGATGACCAANGGAACGTCTTCGGTTTGGAAAG
HKR069206 ARe73A06 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACCAANGGAACGTCATCGTTTGGAAAGCG
HKR071372 ARe78H04 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR071682 ARe79D10 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR072059 ARe80C11 pKA1U5 NM_000997.4  
GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR072546 ARe81G02 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR072553 ARe81G09 pKA1U5 NM_000997.4  
ATCCTGGTGGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATA
HKR074500 ARe86E04 pKA1U5 NM_000997.4  
TGGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR074884 ARe87D12 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR077379 ARe93H11 pKA1U5 NM_000997.4  
TGGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACNAAGGGAACGTCATCGTTTGGAAAG
HKR164402 ARi11A02 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR164552 ARi11G08 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR165254 ARi13C06 pGCAP10 NM_000997.4  
GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
HKR165350 ARi13G06 pGCAP10 NM_000997.4  
GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
HKR165724 ARi14F04 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR166528 ARi16F08 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR166852 ARi17C04 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR168034 ARi20B10 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR169279 ARi23D07 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR169329 ARi23F09 pGCAP10 NM_000997.4  
GAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACAC
HKR171351 ARi28G07 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR172025 ARi30B01 pGCAP10 NM_000997.4  
GCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCA
HKR176426 ARi41B02 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR177206 ARi43A06 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR177250 ARi43C02 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR178571 ARi46H03 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR180030 ARi50B06 pGCAP10 NM_000997.4  
GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR183301 ARi58E05 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR186945 ARi67G01 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR208116 ARiS020E20 pGCAP10 NM_000997.4  
TAATGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAA
HKR208350 ARiS020O14 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR218063 ARiS045C15 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCANAANCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR218260 ARiS045K20 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR218327 ARiS045N15 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR219737 ARiS049F17 pGCAP10 NM_000997.4  
GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR222299 ARiS055M11 pGCAP10 NM_000997.4  
GCTTTTTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGG
HKR222346 ARiS055O10 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR234202 ARiS085I10 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR234270 ARiS085L06 pGCAP10 NM_000997.4  
GCTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATC
HKR234923 ARiS087F03 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR238474 ARiS096D02 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR238754 ARiS096O18 pGCAP10 NM_000997.4  
TGCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCG
HKR247206 ARiS118A06 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR247423 ARiS118J07 pGCAP10 NM_000997.4  
GCTTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCAT
HKR247578 ARiS118P18 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR249090 ARiS122M02 pGCAP10 NM_000997.4  
CGGCCGGCCGATGCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGG
HKR260072 ARiS150C24 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR260102 ARiS150E06 pGCAP10 NM_000997.4  
GCTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATC
HKR260292 ARiS150M04 pGCAP10 NM_000997.4  
GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
HKR276407 ARiS191A07 pGCAP10 NM_000997.4  
GGTNTNTGGTCTCNGCCGGNNACNCGAGNNGACCAAGGGAACGTCNTCGTTTGGAAAGCG
HKR276453 ARiS191C05 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR276537 ARiS191F17 pGCAP10 NM_000997.4  
GTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR276544 ARiS191F24 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR276611 ARiS191I19 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR321283 RBb03D11 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR321698 RBb04E02 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR323212 RBb08A12 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR326807 RBb17A07 pKA1U5 NM_000997.4  
GCTTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCAT
HKR327229 RBb18B05 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR328058 RBb20C10 pKA1U5 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR329628 RBb24B04 pGCAP1 NM_000997.4  
GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
HKR332176 RBb30H08 pGCAP1 NM_000997.4  
GTGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR332523 RBb31F03 pGCAP1 NM_000997.4  
HKR334458 RBb36C10 pGCAP1 NM_000997.4  
GGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCAC
HKR337375 RBb43H07 pGCAP1 NM_000997.4  
GAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACACGT
HKR338532 RBb46F12 pGCAP1 NM_000997.4  
GCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCA
HKR347277 RBb68D05 pGCAP1 NM_000997.4  
GCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCA
HKR347379 RBb68H11 pGCAP1 NM_000997.4  
CTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGT
HKR347751 RBb69G07 pGCAP1 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR348578 RBb71H10 pGCAP1 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR361302 RBd03E06 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR361655 RBd04C07 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR364854 RBd12C06 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR364878 RBd12D06 pGCAP10 NM_000997.4  
GAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACAC
HKR366010 RBd15A10 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR366572 RBd16H04 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR367332 RBd18F12 pGCAP10 NM_000997.4  
GTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGT
HKR368410 RBd21A10 pGCAP10 NM_000997.4  
TGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR370569 RBd26H01 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR371699 RBd29E03 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR374832 RBd37B08 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR376547 RBd41G03 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR376807 RBd42A07 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR377258 RBd43C10 pGCAP10 NM_000997.4  
GTCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCG
HKR377282 RBd43D10 pGCAP10 NM_000997.4  
HKR378945 RBd47G01 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR380058 RBd50C10 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR383259 RBd58C11 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTNATCGTTTGGAAAGCG
HKR384405 RBd61A05 pGCAP10 NM_000997.4  
GGACGGGACGCGGCTCCGGGAACATGGCTCGCTTCGCTCTGACTGTTGTCCGGCATGGAG
HKR384407 RBd61A07 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCACAANATNGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR385778 RBd64H10 pGCAP10 NM_000997.4  
GCTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR386076 RBd65D04 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR386554 RBd66G10 pGCAP10 NM_000997.4  
GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR386954 RBd67G10 pGCAP10 NM_000997.4  
GAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGCAATAAGACGCACAC
HKR387301 RBd68E05 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR388506 RBd71E10 pGCAP10 NM_000997.4  
GTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR389675 RBd74D03 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR389705 RBd74E09 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR390007 RBd75A07 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR390850 RBd77C02 pGCAP10 NM_000997.4  
GCTTTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAA
HKR391752 RBd79G08 pGCAP10 NM_000997.4  
GNTTTCTGNNCTCGGCCGCANAAGCGAGATGACAAAGGGAACGTCNTCGTTTGGAAAGNG
HKR394176 RBd85H08 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR396502 RBd91E06 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR399345 RBd98G01 pGCAP10 NM_000997.4  
GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
HKR399607 RBd99A07 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR399777 RBd99H09 pGCAP10 NM_000997.4  
TGCTTTTCTGGTCCCGCCCTGCTAGCCGATATGACGAACGGAANNCNATCGTTGGGAAAN
HKR405265 RBdS013C17 pGCAP10 NM_000997.4  
GCTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR405420 RBdS013J04 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR405671 RBdS014C23 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR405735 RBdS014F15 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR409172 RBdS022P12 pGCAP10 NM_000997.4  
GCTTTTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAA
HKR420486 RBdS051D14 pGCAP10 NM_000997.4  
GCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGC
HKR428011 RBdS070A11 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR428222 RBdS070J06 pGCAP10 NM_000997.4  
GGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAG
HKR430150 RBdS075G06 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR432742 RBdS081O06 pGCAP10 NM_000997.4  
GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
HKR442167 RBdS105G23 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR444057 RBdS110C09 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR444104 RBdS110E08 pGCAP10 NM_000997.4  
TGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR452866 RBdS132C18 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG
HKR452986 RBdS132H18 pGCAP10 NM_000997.4  
GCTCTTCCGGTCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGT
HKR461714 RBdS154E18 pGCAP10 NM_000997.4  
TGCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGC
HKR470876 RBdS177D04 pGCAP10 NM_000997.4  
GAGTNGCTTTCTGGTCTCNGCCGCANAANCNAGATGACGAAGGGAACGTCNTCGTTTGGA
HKR470924 RBdS177F04 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCANAAGCGAGATGACNAANGGAACGTCATCGTTTGGAAAGCG
HKR475166 RBdS187P06 pGCAP10 NM_000997.4  
GCTTTCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl