Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051D14

Clone ID RBdS051D14
HP ID HP00050
Gene ID 6167
Gene Symbol RPL37
Protein Name ribosomal protein L37
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000997.4
Length of RefSeq (bp) 1586
Chromosome 5p13
Reference DDBJ accession
UniGene Hs.80545
5'-terminal sequence GCTGGTCTCGGCCGCAGAAGCGAGATGACGAAGGGAACGTCATCGTTTGGAAAGCGTCGC
2011.08.28