Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00034

HP ID(1) HP00034
Gene ID(2) 6124
Gene Symbol finder RPL4
Protein Name ribosomal protein L4
RefSeq NM_000968.2
Length of RefSeq (bp) 1449
Chromosome 15q22
Reference DDBJ accession
UniGene Hs.644628

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11F07 pKA1U5 GCTTTTCCTGCGGCAGCAAGCCGGGCTGAGAGGCCNCGTGGNGTGNCTCCTCTCTCCGCC
ARe29G06 pKA1U5 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARe36B08 pKA1U5 GCCTTTTCCTGGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCA
ARe38F03 pKA1U5 GGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGNGATGATGCTCGCCCACTGATATC
ARe48B11 pKA1U5 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARe56C12 pKA1U5 TTGAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCNCCTCTCTCCGCCATGGCGTGTGCTCG
ARe59B07 pKA1U5 AAAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTTGTGCTCGCCCACTGATATCGGT
ARe59C08 pKA1U5 GCTTTTCCTGTTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
ARe60G03 pKA1U5 GCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTTCTCCTCTCTCCGCCATGGCGTG
ARe64G05 pKA1U5 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARe81E12 pKA1U5 GCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
ARe94B10 pKA1U5 GTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGT
ARe94H11 pKA1U5 GCTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
ARe96D01 pKA1U5 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARi05B04 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARi07B06 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARi09B10 pGCAP10 CCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARi09F10 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARi22C02 pGCAP10 TTTTTTTTTTTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCT
ARi37G06 pGCAP10 GAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCAC
ARi47H05 pGCAP10 GCTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
ARi53C04 pGCAP10 GCCCCGCCCTCCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCCCGTGC
ARi55F09 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARi69C12 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARiS020B21 pGCAP10 GCTTTTCCTGTGGCACCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARiS023B13 pGCAP10 GTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGT
ARiS049O09 pGCAP10 CNGCCGGCCGATGCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTC
ARiS096A04 pGCAP10 GGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGG
ARiS109J15 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARiS150A14 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARiS161O02 pGCAP10 GCTTTTCCTGTGGCAGCACCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARiS194B11 pGCAP10 GCTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
ARiS198C21 pGCAP10
ARiS198N01 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
ARiS198O13 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBb04F03 pKA1U5 GTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGT
RBb17C10 pKA1U5 GAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCAC
RBb19C02 pKA1U5 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBb25G06 pGCAP1 GGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGG
RBb45B09 pGCAP1 TGGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTG
RBb70H12 pGCAP1 GGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGTGTAC
RBb71A03 pGCAP1 GCTTCCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
RBd11D01 pGCAP10 TGCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
RBd16E08 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd27F09 pGCAP10 GCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
RBd29D08 pGCAP10 GGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGC
RBd31C02 pGCAP10 GCCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
RBd43E10 pGCAP10 TTGCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCA
RBd49D08 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd51A11 pGCAP10 TGGCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCA
RBd60H11 pGCAP10 GTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGC
RBd61F06 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd65D10 pGCAP10 GCTTTTCCTTTTCCTGTGGCAGCNGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCC
RBd66G01 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd68A09 pGCAP10 GAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGT
RBd72F07 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd79G12 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd79H10 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd81C11 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd83G05 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBd87H08 pGCAP10 GGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGC
RBd99G07 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS013A16 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS040B08 pGCAP10 TGCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGT
RBdS040O12 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS051M22 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS051P02 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS070J13 pGCAP10 GCTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
RBdS070O14 pGCAP10 ACTGTGGCTTCCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCT
RBdS075C22 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS083P05 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS104L14 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS132A24 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS154C18 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
RBdS154O08 pGCAP10 GCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
RBdS177B16 pGCAP10 GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl