Prev. |  KEGG KO K02930 > 

RIKEN DNA Bank Human Resource - RPL4

Gene ID NCBI Gene 6124 |  KEGG hsa:6124
Gene Symbol RPL4
Protein Name ribosomal protein L4
Synonyms L4
Ortholog resources KEGG ortholog (KEGG orthology K02930) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035211 IRAK088A11 pCMV-SPORT6 BC040610 NM_000968 Full
HGY067011 IRAK167I19 pBluescriptR BC066925 NM_000968 Full
HGY081667 IRAL004C19 pOTB7 BC001365 NM_000968 Full
HGY085715 IRAL014E19 pOTB7 BC005817 NM_000968 Full
HGY086846 IRAL017B22 pOTB7 BC007748 NM_000968 Full
HGY089512 IRAL023M24 pOTB7 BC007996 NM_000968 Full
HGY090336 IRAL025N24 pOTB7 BC009888 NM_000968 Full
HGY090825 IRAL027B01 pOTB7 BC010151 NM_000968 Full
HGY091821 IRAL029J05 pOTB7 BC014653 NM_000968 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE085643 M01C014B19 pDONR221 FLJ04-G10 AK130784 NM_000968  
HGE085691 M01C014D19 pDONR221 FLJ04-G10 AK130784 NM_000968  
HGE085739 M01C014F19 pDONR221 FLJ04-G10 AK130784 NM_000968  
HGE085787 M01C014H19 pDONR221 FLJ04-G10 AK130784 NM_000968  
HGE085835 M01C014J19 pDONR221 FLJ04-G10 AK130784 NM_000968  
HGE085883 M01C014L19 pDONR221 FLJ04-G10 AK130784 NM_000968  
HGE085931 M01C014N19 pDONR221 FLJ04-G10 AK130784 NM_000968  
HGE085979 M01C014P19 pDONR221 FLJ04-G10 AK130784 NM_000968  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044527 ARe11F07 pKA1U5 NM_000968.2  
GCTTTTCCTGCGGCAGCAAGCCGGGCTGAGAGGCCNCGTGGNGTGNCTCCTCTCTCCGCC
HKR051750 ARe29G06 pKA1U5 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR054432 ARe36B08 pKA1U5 NM_000968.2  
GCCTTTTCCTGGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCA
HKR055323 ARe38F03 pKA1U5 NM_000968.2  
GGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGNGATGATGCTCGCCCACTGATATC
HKR059235 ARe48B11 pKA1U5 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR062460 ARe56C12 pKA1U5 NM_000968.2  
TTGAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCNCCTCTCTCCGCCATGGCGTGTGCTCG
HKR063631 ARe59B07 pKA1U5 NM_000968.2  
AAAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTTGTGCTCGCCCACTGATATCGGT
HKR063656 ARe59C08 pKA1U5 NM_000968.2  
GCTTTTCCTGTTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
HKR064147 ARe60G03 pKA1U5 NM_000968.2  
GCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTTCTCCTCTCTCCGCCATGGCGTG
HKR065749 ARe64G05 pKA1U5 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR072508 ARe81E12 pKA1U5 NM_000968.2  
GCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
HKR077634 ARe94B10 pKA1U5 NM_000968.2  
GTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGT
HKR077779 ARe94H11 pKA1U5 NM_000968.2  
GCTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
HKR078473 ARe96D01 pKA1U5 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR162028 ARi05B04 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR162830 ARi07B06 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR163634 ARi09B10 pGCAP10 NM_000968.2  
CCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR163730 ARi09F10 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR168850 ARi22C02 pGCAP10 NM_000968.2  
TTTTTTTTTTTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCT
HKR174950 ARi37G06 pGCAP10 NM_000968.2  
GAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCAC
HKR178973 ARi47H05 pGCAP10 NM_000968.2  
GCTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
HKR181252 ARi53C04 pGCAP10 NM_000968.2  
GCCCCGCCCTCCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCCCGTGC
HKR182129 ARi55F09 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR187660 ARi69C12 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR208045 ARiS020B21 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCACCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR209237 ARiS023B13 pGCAP10 NM_000968.2  
GTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGT
HKR219945 ARiS049O09 pGCAP10 NM_000968.2  
CNGCCGGCCGATGCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTC
HKR238404 ARiS096A04 pGCAP10 NM_000968.2  
GGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGG
HKR243831 ARiS109J15 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR260014 ARiS150A14 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR264738 ARiS161O02 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCACCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR277635 ARiS194B11 pGCAP10 NM_000968.2  
GCTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
HKR279269 ARiS198C21 pGCAP10 NM_000968.2  
HKR279513 ARiS198N01 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR279549 ARiS198O13 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR321723 RBb04F03 pKA1U5 NM_000968.2  
GTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGT
HKR326858 RBb17C10 pKA1U5 NM_000968.2  
GAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCAC
HKR327650 RBb19C02 pKA1U5 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR330150 RBb25G06 pGCAP1 NM_000968.2  
GGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGG
HKR338033 RBb45B09 pGCAP1 NM_000968.2  
TGGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTG
HKR348180 RBb70H12 pGCAP1 NM_000968.2  
GGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGTGTAC
HKR348403 RBb71A03 pGCAP1 NM_000968.2  
GCTTCCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
HKR364473 RBd11D01 pGCAP10 NM_000968.2  
TGCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
HKR366504 RBd16E08 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR370929 RBd27F09 pGCAP10 NM_000968.2  
GCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
HKR371680 RBd29D08 pGCAP10 NM_000968.2  
GGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGC
HKR372450 RBd31C02 pGCAP10 NM_000968.2  
GCCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
HKR377306 RBd43E10 pGCAP10 NM_000968.2  
TTGCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCA
HKR379680 RBd49D08 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR380411 RBd51A11 pGCAP10 NM_000968.2  
TGGCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCA
HKR384179 RBd60H11 pGCAP10 NM_000968.2  
GTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGC
HKR384526 RBd61F06 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR386082 RBd65D10 pGCAP10 NM_000968.2  
GCTTTTCCTTTTCCTGTGGCAGCNGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCC
HKR386545 RBd66G01 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR387209 RBd68A09 pGCAP10 NM_000968.2  
GAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGCTCGCCCACTGATATCGGT
HKR388927 RBd72F07 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR391756 RBd79G12 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR391778 RBd79H10 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR392459 RBd81C11 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR393349 RBd83G05 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR394976 RBd87H08 pGCAP10 NM_000968.2  
GGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGTGTGC
HKR399751 RBd99G07 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR405216 RBdS013A16 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR416032 RBdS040B08 pGCAP10 NM_000968.2  
TGCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATGGCGT
HKR416348 RBdS040O12 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR420710 RBdS051M22 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR420762 RBdS051P02 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR428229 RBdS070J13 pGCAP10 NM_000968.2  
GCTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCAT
HKR428350 RBdS070O14 pGCAP10 NM_000968.2  
ACTGTGGCTTCCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCT
HKR430070 RBdS075C22 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR433565 RBdS083P05 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR441878 RBdS104L14 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR452824 RBdS132A24 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR461666 RBdS154C18 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG
HKR461944 RBdS154O08 pGCAP10 NM_000968.2  
GCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
HKR470840 RBdS177B16 pGCAP10 NM_000968.2  
GCTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGCCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl