Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154O08

Clone ID RBdS154O08
HP ID HP00034
Gene ID 6124
Gene Symbol RPL4
Protein Name ribosomal protein L4
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000968.2
Length of RefSeq (bp) 1449
Chromosome 15q22
Reference DDBJ accession
UniGene Hs.644628
5'-terminal sequence GCTTTTTTTTCCTGTGGCAGCAGCCGGGCTGAGAGGAGCGTGGCTGTCTCCTCTCTCCGC
2011.08.28