Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00027

HP ID(1) HP00027
Gene ID(2) 6210
Gene Symbol finder RPS15A
Protein Name ribosomal protein S15a
RefSeq NM_001019.4
Length of RefSeq (bp) 554
Chromosome 16p
Reference DDBJ accession
UniGene Hs.370504

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07D12 pKA1U5 AGGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGAT
ARe12B06 pKA1U5 GGAGAGCTCCAATTTCATCCGTCTGCCATCGGCGCCATCCTGCAATCTAAGCCACAATGG
ARe15C05 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe17D09 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe19A12 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe21A02 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe23G04 pKA1U5 CTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCT
ARe38C09 pKA1U5 ATCCTGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCA
ARe41E02 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe46D02 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe56C03 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATNCCTNNNCATGAATGTCCTGGCAGATG
ARe63F06 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe66G08 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe67C12 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe75H07 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATNCGTTNCGCATGAATGTCCTGGCAGAT
ARe88G10 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe92A11 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARe94E01 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARf03B04 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARf04C01 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARf05F06 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARi06H11 pGCAP10 CGGCCGGCCGATGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGT
ARi07A07 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARi08H03 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARi11B03 pGCAP10 TGCTTTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
ARi15F02 pGCAP10 CGGCCGGCCGATGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAAT
ARi34F06 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARi48G09 pGCAP10 GCCATAACTCCGTGCGCTCTCCCCTCCCGTCCTCTTTCCGCCATCTTTCCGCGCCGCCAC
ARi49H06 pGCAP10 GCTCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGAT
ARi55C06 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARi56A12 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARi69B10 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS013A07 pGCAP10 GCTCTTTCCNCCANCTTNCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS049N11 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS085A18 pGCAP10 TGCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCAT
ARiS085C03 pGCAP10 GTCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
ARiS087B08 pGCAP10 CGGCCGGCCGATGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGT
ARiS088J20 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS096D10 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS096I19 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS096J22 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS109F13 pGCAP10 TCTTTCCNNNNTCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
ARiS118E04 pGCAP10 GCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
ARiS118H09 pGCAP10 GCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
ARiS122E12 pGCAP10 GCTTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCT
ARiS122L19 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS161E01 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS161G10 pGCAP10 GCTCTTTCCGCCATCTTTCCNCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS191D09 pGCAP10 GNGTTTNAATCCNGNTGCNACCAANGANTAGGTGGTGGGATCTCACCNNGNGNCCNANNN
ARiS191I05 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS191N21 pGCAP10 GTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCT
ARiS194J15 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
ARiS198B13 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBb01B03 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATC
RBb05G09 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTTGCGCATGAATGTCCTGGCAGATG
RBb09H06 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTTGCGCATGAATGTCCTGGCAGATG
RBb10D10 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBb21B07 pKA1U5 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBb24G03 pGCAP1 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBb26D07 pGCAP1 TCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
RBb54A07 pGCAP1 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBb66C09 pGCAP1 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd02H08 pGCAP10 GGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATCCGTCTGCCATCGGCGCCAT
RBd05F02 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd08G07 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd11A11 pGCAP10 TGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
RBd15E11 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd20D10 pGCAP10 TGGCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGA
RBd21C04 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd38G06 pGCAP10 GTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCT
RBd39C06 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd57D01 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd63F04 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd66B07 pGCAP10 GCTCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGAT
RBd71F03 pGCAP10 CGGCCGGCCGATTGTGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAA
RBd72E04 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd73A09 pGCAP10 GCTTGCNCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAG
RBd78A05 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd79B01 pGCAP10 GAGCACTCTCTGAGAGCTCCAATTTCATCCGTCTGCCATCGGCGCCATCCTGCAATCTAA
RBd81C05 pGCAP10 TGCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCAT
RBd84A12 pGCAP10 GCTCTTTCCGCCNTCTTTCCCCGCCNCCNCAATGGTGCGCATGAATGTCCTGGNANATGC
RBd84D12 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd86E05 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd88D07 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd88G06 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd90C07 pGCAP10 GCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
RBd94A09 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd94G11 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBd99A12 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS007F17 pGCAP10 TGGTGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAG
RBdS007I22 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS007P24 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS013C22 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS014D17 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS014I02 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS014I20 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATC
RBdS015D18 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS015J16 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS022H18 pGCAP10 GTCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
RBdS040M21 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS051C24 pGCAP10 GCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
RBdS051O01 pGCAP10 GGGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGAT
RBdS051P04 pGCAP10 GCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
RBdS070A06 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS075H21 pGCAP10 GGTCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGA
RBdS075K13 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS075P01 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS083I23 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS083J10 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS083O06 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS104F08 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATC
RBdS132E09 pGCAP10 CCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
RBdS154B23 pGCAP10 CGGCCGGCCGATGCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGC
RBdS187K21 pGCAP10 GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl