Prev. |  KEGG KO K02957 > 

RIKEN DNA Bank Human Resource - RPS15A

Gene ID NCBI Gene 6210 |  KEGG hsa:6210
Gene Symbol RPS15A
Protein Name ribosomal protein S15a
Synonyms DBA20|S15a
Ortholog resources KEGG ortholog (KEGG orthology K02957) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027959 IRAK069O23 pCMV-SPORT6 BC030569 NM_001030009 Full
HGX042976 IRAK107H08 pCMV-SPORT6 BC046113 NM_001030009 Full
HGY081321 IRAL003F01 pOTB7 BC001697 NM_001030009 Full/var
HGY095753 IRAL039G09 pOTB7 BC032115 NM_001030009 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042884 ARe07D12 pKA1U5 NM_001019.4  
AGGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGAT
HKR044830 ARe12B06 pKA1U5 NM_001019.4  
GGAGAGCTCCAATTTCATCCGTCTGCCATCGGCGCCATCCTGCAATCTAAGCCACAATGG
HKR046053 ARe15C05 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR046881 ARe17D09 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR047612 ARe19A12 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR048402 ARe21A02 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR049348 ARe23G04 pKA1U5 NM_001019.4  
CTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCT
HKR055257 ARe38C09 pKA1U5 NM_001019.4  
ATCCTGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCA
HKR056498 ARe41E02 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR058474 ARe46D02 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR062451 ARe56C03 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATNCCTNNNCATGAATGTCCTGGCAGATG
HKR065326 ARe63F06 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR066552 ARe66G08 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR066860 ARe67C12 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR070175 ARe75H07 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATNCGTTNCGCATGAATGTCCTGGCAGAT
HKR075354 ARe88G10 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR076811 ARe92A11 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR077697 ARe94E01 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR081228 ARf03B04 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR081649 ARf04C01 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR082126 ARf05F06 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR162579 ARi06H11 pGCAP10 NM_001019.4  
CGGCCGGCCGATGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGT
HKR162807 ARi07A07 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR163371 ARi08H03 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR164427 ARi11B03 pGCAP10 NM_001019.4  
TGCTTTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
HKR166122 ARi15F02 pGCAP10 NM_001019.4  
CGGCCGGCCGATGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAAT
HKR173726 ARi34F06 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR179353 ARi48G09 pGCAP10 NM_001019.4  
GCCATAACTCCGTGCGCTCTCCCCTCCCGTCCTCTTTCCGCCATCTTTCCGCGCCGCCAC
HKR179774 ARi49H06 pGCAP10 NM_001019.4  
GCTCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGAT
HKR182054 ARi55C06 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR182412 ARi56A12 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR187634 ARi69B10 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR205207 ARiS013A07 pGCAP10 NM_001019.4  
GCTCTTTCCNCCANCTTNCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR219923 ARiS049N11 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR234018 ARiS085A18 pGCAP10 NM_001019.4  
TGCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCAT
HKR234051 ARiS085C03 pGCAP10 NM_001019.4  
GTCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
HKR234832 ARiS087B08 pGCAP10 NM_001019.4  
CGGCCGGCCGATGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGT
HKR235436 ARiS088J20 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR238482 ARiS096D10 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR238611 ARiS096I19 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR238638 ARiS096J22 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR243733 ARiS109F13 pGCAP10 NM_001019.4  
TCTTTCCNNNNTCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
HKR247300 ARiS118E04 pGCAP10 NM_001019.4  
GCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
HKR247377 ARiS118H09 pGCAP10 NM_001019.4  
GCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
HKR248908 ARiS122E12 pGCAP10 NM_001019.4  
GCTTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCT
HKR249083 ARiS122L19 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR264497 ARiS161E01 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR264554 ARiS161G10 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCNCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR276481 ARiS191D09 pGCAP10 NM_001019.4  
GNGTTTNAATCCNGNTGCNACCAANGANTAGGTGGTGGGATCTCACCNNGNGNCCNANNN
HKR276597 ARiS191I05 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR276733 ARiS191N21 pGCAP10 NM_001019.4  
GTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCT
HKR277831 ARiS194J15 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR279237 ARiS198B13 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR320427 RBb01B03 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATC
HKR322153 RBb05G09 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTTGCGCATGAATGTCCTGGCAGATG
HKR323774 RBb09H06 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTTGCGCATGAATGTCCTGGCAGATG
HKR324082 RBb10D10 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR328431 RBb21B07 pKA1U5 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR329747 RBb24G03 pGCAP1 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR330479 RBb26D07 pGCAP1 NM_001019.4  
TCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
HKR341607 RBb54A07 pGCAP1 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR346457 RBb66C09 pGCAP1 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR360976 RBd02H08 pGCAP10 NM_001019.4  
GGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATCCGTCTGCCATCGGCGCCAT
HKR362122 RBd05F02 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR363351 RBd08G07 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR364411 RBd11A11 pGCAP10 NM_001019.4  
TGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
HKR366107 RBd15E11 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR368082 RBd20D10 pGCAP10 NM_001019.4  
TGGCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGA
HKR368452 RBd21C04 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR375350 RBd38G06 pGCAP10 NM_001019.4  
GTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCT
HKR375654 RBd39C06 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR382873 RBd57D01 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR385324 RBd63F04 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR386431 RBd66B07 pGCAP10 NM_001019.4  
GCTCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGAT
HKR388523 RBd71F03 pGCAP10 NM_001019.4  
CGGCCGGCCGATTGTGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAA
HKR388900 RBd72E04 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR389209 RBd73A09 pGCAP10 NM_001019.4  
GCTTGCNCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAG
HKR391205 RBd78A05 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR391625 RBd79B01 pGCAP10 NM_001019.4  
GAGCACTCTCTGAGAGCTCCAATTTCATCCGTCTGCCATCGGCGCCATCCTGCAATCTAA
HKR392453 RBd81C05 pGCAP10 NM_001019.4  
TGCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCAT
HKR393612 RBd84A12 pGCAP10 NM_001019.4  
GCTCTTTCCGCCNTCTTTCCCCGCCNCCNCAATGGTGCGCATGAATGTCCTGGNANATGC
HKR393684 RBd84D12 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR394501 RBd86E05 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR395279 RBd88D07 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR395350 RBd88G06 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR396055 RBd90C07 pGCAP10 NM_001019.4  
GCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
HKR397609 RBd94A09 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR397755 RBd94G11 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR399612 RBd99A12 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR402937 RBdS007F17 pGCAP10 NM_001019.4  
TGGTGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAG
HKR403014 RBdS007I22 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR403184 RBdS007P24 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR405270 RBdS013C22 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR405689 RBdS014D17 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR405794 RBdS014I02 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR405812 RBdS014I20 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATC
HKR406090 RBdS015D18 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR406232 RBdS015J16 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR408986 RBdS022H18 pGCAP10 NM_001019.4  
GTCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATG
HKR416309 RBdS040M21 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR420472 RBdS051C24 pGCAP10 NM_001019.4  
GCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
HKR420737 RBdS051O01 pGCAP10 NM_001019.4  
GGGCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGAT
HKR420764 RBdS051P04 pGCAP10 NM_001019.4  
GCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGCTC
HKR428006 RBdS070A06 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR430189 RBdS075H21 pGCAP10 NM_001019.4  
GGTCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGA
HKR430253 RBdS075K13 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR430361 RBdS075P01 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR433415 RBdS083I23 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR433426 RBdS083J10 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR433542 RBdS083O06 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR441728 RBdS104F08 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGCTCCAATTTCATC
HKR452905 RBdS132E09 pGCAP10 NM_001019.4  
CCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC
HKR461647 RBdS154B23 pGCAP10 NM_001019.4  
CGGCCGGCCGATGCTCTTTCCGCCATCTTTCCGCGCCGGTGAGTAGCACTCTCTGAGAGC
HKR475061 RBdS187K21 pGCAP10 NM_001019.4  
GCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGATGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl