Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075H21

Clone ID RBdS075H21
HP ID HP00027
Gene ID 6210
Gene Symbol RPS15A
Protein Name ribosomal protein S15a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001019.4
Length of RefSeq (bp) 554
Chromosome 16p
Reference DDBJ accession
UniGene Hs.370504
5'-terminal sequence GGTCCTCTTTCCGCCATCTTTCCGCGCCGCCACAATGGTGCGCATGAATGTCCTGGCAGA
2011.08.28