Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00015

HP ID(1) HP00015
Gene ID(2) 6188
Gene Symbol finder RPS3
Protein Name ribosomal protein S3
RefSeq NM_001005.3
Length of RefSeq (bp) 855
Chromosome 11q13.3-q13.5
Reference DDBJ accession
UniGene Hs.546286

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04C04 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe06B02 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARe07B01 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARe07H10 pKA1U5 ATCCTGTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAA
ARe08B01 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe10B01 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe12E06 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe18D09 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe20A12 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARe21B12 pKA1U5 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe23B08 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe24D06 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARe29A10 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe29B09 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe32F09 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe33C11 pKA1U5 TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe35B12 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe37B05 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARe41F10 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTTGCAAATATCCAAGAAGAGGAA
ARe41G10 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe43F06 pKA1U5 TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe44B07 pKA1U5 GTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
ARe44D03 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe44H07 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGCCNTTGCAAATATCCAAGAAGAGGAAG
ARe45G03 pKA1U5 ATCCTGGCCTTTCCTTTCAGCGGAGCGCGGCGGCAANATGGCAGTGCAAATATCCAAGAA
ARe46C05 pKA1U5 TTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
ARe46G03 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe50G11 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARe51D10 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe52A02 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATNGCNGTGCAAATATCCAAGAAGAGGAA
ARe55A03 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGNCNTTTGCAAATATCCAAGAAGAGGAA
ARe61B03 pKA1U5 GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATCTCNAAGAAGAGGAAGTTTGTCGCTG
ARe65E06 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe69F08 pKA1U5 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe74C08 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe75D09 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGNCANTGCAAATATCCAAGAAGAGGAAG
ARe75H02 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATNGCNGTGCAAATATCCAAGAAGAGGAA
ARe81A10 pKA1U5 GGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTGATGGCATCTTCAA
ARe84B02 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARe84H03 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe89G01 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARe89G03 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe90D12 pKA1U5 GCCTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
ARe90G02 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe91A12 pKA1U5 ATCCTGCTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGA
ARe94G01 pKA1U5 TTTGCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
ARe95A12 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe98B03 pKA1U5 TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARe98C06 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARf01D09 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARf01H06 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARf02H09 pKA1U5 GTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
ARf05C12 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARf05F01 pKA1U5 ATCCTGGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAA
ARi01C05 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi03A06 pGCAP10 TGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
ARi12E08 pGCAP10 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi12G11 pGCAP10 TGAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCT
ARi16E01 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi19D04 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi24A11 pGCAP10 TGCTTTCCTTTCNGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi24G01 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi26D08 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARi28G05 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi30A02 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi31H05 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi34B11 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARi38C09 pGCAP10 GCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTG
ARi39C11 pGCAP10 GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTG
ARi44G05 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi46H09 pGCAP10 GACTCACTTCCGCCCGCGAGCCACTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGG
ARi47B09 pGCAP10 CTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGT
ARi56A01 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARi56A09 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi56D05 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARi67A12 pGCAP10 CGCCTTTCCTTTNAGCGGAGCGCGGCGGCAAGATGGCAGNGCAAATATCCAAGAAGAGGA
ARi69G04 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARi70F09 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARiS008M03 pGCAP10 GCTTTCCTTTCCTTNCNGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
ARiS013L14 pGCAP10 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS020M12 pGCAP10 GCCTTNNCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS023J07 pGCAP10 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS023O04 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS045I10 pGCAP10 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS045L19 pGCAP10 GCCTTTCCTTTCAGCGNANCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS049A16 pGCAP10 GCCTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
ARiS049D06 pGCAP10 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS049P17 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS049P21 pGCAP10 TAATGCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
ARiS055P23 pGCAP10 GCCTTTCCTTTCANCGGANCNCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS085A23 pGCAP10
ARiS085F01 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS085P19 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARiS087K10 pGCAP10 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS096B10 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS096N09 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS109I05 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS109J09 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS118E02 pGCAP10 CTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTC
ARiS150I01 pGCAP10 GCTTTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
ARiS150L19 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS161G18 pGCAP10 GCCTTTCCTTTCNNCGGACCCCGNTGCCAAGATGGCNGTGCNAATATCCAANANNANGAA
ARiS161I09 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS161M11 pGCAP10 GGGCGGGNGANGGGACNCTNANGGCCCATGTGCTGAAAATCCNAANTGCCNNNGAANGTG
ARiS161P09 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS191C21 pGCAP10 GCTTTCCTTTCNGCNGACCCCGNCGGCCAGATGGCAGTGCAANTANNNNAGAAGANGAAG
ARiS191O02 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS198A02 pGCAP10
ARiS198D24 pGCAP10 GCCNTNCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
ARiS198I05 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
ARiS198L21 pGCAP10
ARiS198P01 pGCAP10 TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb01G12 pKA1U5 TGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBb01H09 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb02D09 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBb03G02 pKA1U5 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb05C03 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb07F05 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCNGTGCAAATATCCAAGAAGAGGAA
RBb09E04 pKA1U5 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBb09E10 pKA1U5
RBb10A09 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb15E05 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb17G06 pKA1U5 GCCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBb20H08 pKA1U5 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb23B04 pGCAP1
RBb27F08 pGCAP1 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBb30G02 pGCAP1 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb30H03 pGCAP1 TGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBb32B11 pGCAP1 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb33B01 pGCAP1 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb36A05 pGCAP1 GCCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBb37H02 pGCAP1 GCCTTNCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb38G11 pGCAP1 GTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGT
RBb39F06 pGCAP1 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb43H01 pGCAP1 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBb43H02 pGCAP1
RBb48C10 pGCAP1 CCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBb48H05 pGCAP1 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb52G10 pGCAP1 TTTTTGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCANGTGCAAATATCCAAGAA
RBb60D09 pGCAP1 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb62B04 pGCAP1
RBb64C06 pGCAP1 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBb65B04 pGCAP1 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd02H06 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd10D11 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd14H08 pGCAP10
RBd20B11 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd23A10 pGCAP10
RBd23H11 pGCAP10 GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTG
RBd30C04 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd30E01 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd33F08 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd34A11 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd34G05 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd35F03 pGCAP10 GCCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBd41C02 pGCAP10 GCCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBd41D01 pGCAP10 GGGAAAGANGGCACCGGTATATCCCAGAAGAGGAACTTTGCCCCTGATGGCATCTTCAGC
RBd41D02 pGCAP10 GGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTGATGGCATCTTCAA
RBd42B01 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd46E08 pGCAP10 CGGCCGGCCGATGTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAG
RBd49G07 pGCAP10 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd51C10 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd55G03 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd56E10 pGCAP10 GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGNAGTTTGTCGCTG
RBd57A12 pGCAP10 TTTGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGG
RBd63H10 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd65A05 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd65D11 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd68B04 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd69D01 pGCAP10 GACTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
RBd86F01 pGCAP10 GTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTT
RBd86H04 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd86H11 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd91F02 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBd93D05 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd94E09 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd96B08 pGCAP10 GCTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBd96B09 pGCAP10 GCCTTTCTTTCAGCGGAGCGCGGCGGCAGATGGCAGTGCAAATATCCAAGAAGAGGAAGT
RBd96D02 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd96F04 pGCAP10 GTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBd97C09 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBd97C11 pGCAP10 GCTTTATACTCACTTCCGCCCGCGAGCCACTTCCTTTCCTTTCAGCGGAGCGCGGCGGCA
RBd98G03 pGCAP10 GCTTTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
RBdS007E05 pGCAP10 GTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGC
RBdS013A06 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS013K14 pGCAP10 GCCTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
RBdS014I01 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS015F19 pGCAP10 TGACTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAG
RBdS015G18 pGCAP10 TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS015N18 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS022I13 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBdS040G15 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS040M11 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBdS070C16 pGCAP10 TGCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTT
RBdS105H08 pGCAP10 GCTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
RBdS105I04 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS110P12 pGCAP10 GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTG
RBdS132I20 pGCAP10 CGGCCGGCCGATGCCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATAT
RBdS132K17 pGCAP10 GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS154F10 pGCAP10 GCTTTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
RBdS154F23 pGCAP10 GCTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
RBdS154P19 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBdS156A04 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS156B23 pGCAP10 GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
RBdS156G14 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS177L17 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
RBdS187A22 pGCAP10 GCTTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
RBdS187G14 pGCAP10 GCCTTTCCTTTCAGCGGAGCGCGGCGGNANATGGCAGTGCNNTATCCAAGANGAGGANTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl