Prev. |  KEGG KO K02985 > 

RIKEN DNA Bank Human Resource - RPS3

Gene ID NCBI Gene 6188 |  KEGG hsa:6188
Gene Symbol RPS3
Protein Name ribosomal protein S3
Synonyms S3
Ortholog resources KEGG ortholog (KEGG orthology K02985) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010723 IRAK026N11 pCMV-SPORT6 BC013196 NM_001005 Partial
HGX066485 IRAK166D13 pCMV-SPORT6 BC071669 NM_001005 Partial
HGY083564 IRAL008P04 pOTB7 BC003577 NM_001005 Partial
HGY083678 IRAL009D06 pOTB7 BC003137 NM_001005 Full
HGY096571 IRAL041H03 pDNR-LIB BC034149 NM_001005 Full
HGY103485 IRAL058L21 pOTB7 BC071917 NM_001005 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041652 ARe04C04 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR042426 ARe06B02 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR042825 ARe07B01 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR042978 ARe07H10 pKA1U5 NM_001005.3  
ATCCTGTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAA
HKR043225 ARe08B01 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR044025 ARe10B01 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR044902 ARe12E06 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR047281 ARe18D09 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR048012 ARe20A12 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR048436 ARe21B12 pKA1U5 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR049232 ARe23B08 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR049678 ARe24D06 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR051610 ARe29A10 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR051633 ARe29B09 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR052929 ARe32F09 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR053259 ARe33C11 pKA1U5 NM_001005.3  
TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR054036 ARe35B12 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR054829 ARe37B05 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR056530 ARe41F10 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTTGCAAATATCCAAGAAGAGGAA
HKR056554 ARe41G10 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR057326 ARe43F06 pKA1U5 NM_001005.3  
TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR057631 ARe44B07 pKA1U5 NM_001005.3  
GTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR057675 ARe44D03 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR057775 ARe44H07 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGCCNTTGCAAATATCCAAGAAGAGGAAG
HKR058147 ARe45G03 pKA1U5 NM_001005.3  
ATCCTGGCCTTTCCTTTCAGCGGAGCGCGGCGGCAANATGGCAGTGCAAATATCCAAGAA
HKR058453 ARe46C05 pKA1U5 NM_001005.3  
TTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR058547 ARe46G03 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR060155 ARe50G11 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR060482 ARe51D10 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR060802 ARe52A02 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATNGCNGTGCAAATATCCAAGAAGAGGAA
HKR062003 ARe55A03 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGNCNTTTGCAAATATCCAAGAAGAGGAA
HKR064427 ARe61B03 pKA1U5 NM_001005.3  
GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATCTCNAAGAAGAGGAAGTTTGTCGCTG
HKR066102 ARe65E06 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR067728 ARe69F08 pKA1U5 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR069656 ARe74C08 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR070081 ARe75D09 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGNCANTGCAAATATCCAAGAAGAGGAAG
HKR070170 ARe75H02 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATNGCNGTGCAAATATCCAAGAAGAGGAA
HKR072410 ARe81A10 pKA1U5 NM_001005.3  
GGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTGATGGCATCTTCAA
HKR073626 ARe84B02 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR073771 ARe84H03 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR075745 ARe89G01 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR075747 ARe89G03 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR076084 ARe90D12 pKA1U5 NM_001005.3  
GCCTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
HKR076146 ARe90G02 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR076412 ARe91A12 pKA1U5 NM_001005.3  
ATCCTGCTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGA
HKR077745 ARe94G01 pKA1U5 NM_001005.3  
TTTGCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
HKR078012 ARe95A12 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR079227 ARe98B03 pKA1U5 NM_001005.3  
TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR079254 ARe98C06 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR080481 ARf01D09 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR080574 ARf01H06 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR080977 ARf02H09 pKA1U5 NM_001005.3  
GTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR082060 ARf05C12 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR082121 ARf05F01 pKA1U5 NM_001005.3  
ATCCTGGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAA
HKR160453 ARi01C05 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR161206 ARi03A06 pGCAP10 NM_001005.3  
TGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR164904 ARi12E08 pGCAP10 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR164955 ARi12G11 pGCAP10 NM_001005.3  
TGAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCT
HKR166497 ARi16E01 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR167676 ARi19D04 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR169611 ARi24A11 pGCAP10 NM_001005.3  
TGCTTTCCTTTCNGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR169745 ARi24G01 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR170480 ARi26D08 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR171349 ARi28G05 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR172002 ARi30A02 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR172573 ARi31H05 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR173635 ARi34B11 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR175257 ARi38C09 pGCAP10 NM_001005.3  
GCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTG
HKR175659 ARi39C11 pGCAP10 NM_001005.3  
GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTG
HKR177749 ARi44G05 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR178577 ARi46H09 pGCAP10 NM_001005.3  
GACTCACTTCCGCCCGCGAGCCACTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGG
HKR178833 ARi47B09 pGCAP10 NM_001005.3  
CTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGT
HKR182401 ARi56A01 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR182409 ARi56A09 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR182477 ARi56D05 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR186812 ARi67A12 pGCAP10 NM_001005.3  
CGCCTTTCCTTTNAGCGGAGCGCGGCGGCAAGATGGCAGNGCAAATATCCAAGAAGAGGA
HKR187748 ARi69G04 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR188129 ARi70F09 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR203491 ARiS008M03 pGCAP10 NM_001005.3  
GCTTTCCTTTCCTTNCNGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
HKR205478 ARiS013L14 pGCAP10 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR208300 ARiS020M12 pGCAP10 NM_001005.3  
GCCTTNNCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR209423 ARiS023J07 pGCAP10 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR209540 ARiS023O04 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR218202 ARiS045I10 pGCAP10 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR218283 ARiS045L19 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGNANCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR219616 ARiS049A16 pGCAP10 NM_001005.3  
GCCTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
HKR219678 ARiS049D06 pGCAP10 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR219977 ARiS049P17 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR219981 ARiS049P21 pGCAP10 NM_001005.3  
TAATGCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
HKR222383 ARiS055P23 pGCAP10 NM_001005.3  
GCCTTTCCTTTCANCGGANCNCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR234023 ARiS085A23 pGCAP10 NM_001005.3  
HKR234121 ARiS085F01 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR234379 ARiS085P19 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR235050 ARiS087K10 pGCAP10 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR238434 ARiS096B10 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR238721 ARiS096N09 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR243797 ARiS109I05 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR243825 ARiS109J09 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR247298 ARiS118E02 pGCAP10 NM_001005.3  
CTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTC
HKR260193 ARiS150I01 pGCAP10 NM_001005.3  
GCTTTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
HKR260283 ARiS150L19 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR264562 ARiS161G18 pGCAP10 NM_001005.3  
GCCTTTCCTTTCNNCGGACCCCGNTGCCAAGATGGCNGTGCNAATATCCAANANNANGAA
HKR264601 ARiS161I09 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR264699 ARiS161M11 pGCAP10 NM_001005.3  
GGGCGGGNGANGGGACNCTNANGGCCCATGTGCTGAAAATCCNAANTGCCNNNGAANGTG
HKR264769 ARiS161P09 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR276469 ARiS191C21 pGCAP10 NM_001005.3  
GCTTTCCTTTCNGCNGACCCCGNCGGCCAGATGGCAGTGCAANTANNNNAGAAGANGAAG
HKR276738 ARiS191O02 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR279202 ARiS198A02 pGCAP10 NM_001005.3  
HKR279296 ARiS198D24 pGCAP10 NM_001005.3  
GCCNTNCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR279397 ARiS198I05 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR279485 ARiS198L21 pGCAP10 NM_001005.3  
HKR279561 ARiS198P01 pGCAP10 NM_001005.3  
TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR320556 RBb01G12 pKA1U5 NM_001005.3  
TGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR320577 RBb01H09 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR320881 RBb02D09 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR321346 RBb03G02 pKA1U5 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR322051 RBb05C03 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR322925 RBb07F05 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCNGTGCAAATATCCAAGAAGAGGAA
HKR323700 RBb09E04 pKA1U5 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR323706 RBb09E10 pKA1U5 NM_001005.3  
HKR324009 RBb10A09 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR326101 RBb15E05 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR326950 RBb17G06 pKA1U5 NM_001005.3  
GCCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR328176 RBb20H08 pKA1U5 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR329228 RBb23B04 pGCAP1 NM_001005.3  
HKR330928 RBb27F08 pGCAP1 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR332146 RBb30G02 pGCAP1 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR332171 RBb30H03 pGCAP1 NM_001005.3  
TGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR332835 RBb32B11 pGCAP1 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR333225 RBb33B01 pGCAP1 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR334405 RBb36A05 pGCAP1 NM_001005.3  
GCCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR334970 RBb37H02 pGCAP1 NM_001005.3  
GCCTTNCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR335355 RBb38G11 pGCAP1 NM_001005.3  
GTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGT
HKR335726 RBb39F06 pGCAP1 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR337369 RBb43H01 pGCAP1 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR337370 RBb43H02 pGCAP1 NM_001005.3  
HKR339258 RBb48C10 pGCAP1 NM_001005.3  
CCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR339373 RBb48H05 pGCAP1 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR340954 RBb52G10 pGCAP1 NM_001005.3  
TTTTTGCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCANGTGCAAATATCCAAGAA
HKR344081 RBb60D09 pGCAP1 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR344828 RBb62B04 pGCAP1 NM_001005.3  
HKR345654 RBb64C06 pGCAP1 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR346028 RBb65B04 pGCAP1 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR360974 RBd02H06 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR364083 RBd10D11 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR365776 RBd14H08 pGCAP10 NM_001005.3  
HKR368035 RBd20B11 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR369210 RBd23A10 pGCAP10 NM_001005.3  
HKR369379 RBd23H11 pGCAP10 NM_001005.3  
GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTG
HKR372052 RBd30C04 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR372097 RBd30E01 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR373328 RBd33F08 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR373611 RBd34A11 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR373749 RBd34G05 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR374123 RBd35F03 pGCAP10 NM_001005.3  
GCCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR376450 RBd41C02 pGCAP10 NM_001005.3  
GCCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR376473 RBd41D01 pGCAP10 NM_001005.3  
GGGAAAGANGGCACCGGTATATCCCAGAAGAGGAACTTTGCCCCTGATGGCATCTTCAGC
HKR376474 RBd41D02 pGCAP10 NM_001005.3  
GGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTGATGGCATCTTCAA
HKR376825 RBd42B01 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR378504 RBd46E08 pGCAP10 NM_001005.3  
CGGCCGGCCGATGTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAG
HKR379751 RBd49G07 pGCAP10 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR380458 RBd51C10 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR382147 RBd55G03 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR382506 RBd56E10 pGCAP10 NM_001005.3  
GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGNAGTTTGTCGCTG
HKR382812 RBd57A12 pGCAP10 NM_001005.3  
TTTGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGG
HKR385378 RBd63H10 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR386005 RBd65A05 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR386083 RBd65D11 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR387228 RBd68B04 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR387673 RBd69D01 pGCAP10 NM_001005.3  
GACTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
HKR394521 RBd86F01 pGCAP10 NM_001005.3  
GTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTT
HKR394572 RBd86H04 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR394579 RBd86H11 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR396522 RBd91F02 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR397277 RBd93D05 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR397705 RBd94E09 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR398432 RBd96B08 pGCAP10 NM_001005.3  
GCTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR398433 RBd96B09 pGCAP10 NM_001005.3  
GCCTTTCTTTCAGCGGAGCGCGGCGGCAGATGGCAGTGCAAATATCCAAGAAGAGGAAGT
HKR398474 RBd96D02 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR398524 RBd96F04 pGCAP10 NM_001005.3  
GTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR398857 RBd97C09 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR398859 RBd97C11 pGCAP10 NM_001005.3  
GCTTTATACTCACTTCCGCCCGCGAGCCACTTCCTTTCCTTTCAGCGGAGCGCGGCGGCA
HKR399347 RBd98G03 pGCAP10 NM_001005.3  
GCTTTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
HKR402901 RBdS007E05 pGCAP10 NM_001005.3  
GTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGC
HKR405206 RBdS013A06 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR405454 RBdS013K14 pGCAP10 NM_001005.3  
GCCTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
HKR405793 RBdS014I01 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR406139 RBdS015F19 pGCAP10 NM_001005.3  
TGACTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAG
HKR406162 RBdS015G18 pGCAP10 NM_001005.3  
TGCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR406330 RBdS015N18 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR409005 RBdS022I13 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR416159 RBdS040G15 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR416299 RBdS040M11 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR428064 RBdS070C16 pGCAP10 NM_001005.3  
TGCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTT
HKR442176 RBdS105H08 pGCAP10 NM_001005.3  
GCTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGA
HKR442196 RBdS105I04 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR444372 RBdS110P12 pGCAP10 NM_001005.3  
GAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTTGTCGCTG
HKR453012 RBdS132I20 pGCAP10 NM_001005.3  
CGGCCGGCCGATGCCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATAT
HKR453057 RBdS132K17 pGCAP10 NM_001005.3  
GCTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR461730 RBdS154F10 pGCAP10 NM_001005.3  
GCTTTTTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
HKR461743 RBdS154F23 pGCAP10 NM_001005.3  
GCTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAG
HKR461979 RBdS154P19 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR462404 RBdS156A04 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR462447 RBdS156B23 pGCAP10 NM_001005.3  
GCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
HKR462558 RBdS156G14 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR471081 RBdS177L17 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAA
HKR474822 RBdS187A22 pGCAP10 NM_001005.3  
GCTTTCCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGA
HKR474958 RBdS187G14 pGCAP10 NM_001005.3  
GCCTTTCCTTTCAGCGGAGCGCGGCGGNANATGGCAGTGCNNTATCCAAGANGAGGANTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl