Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070C16

Clone ID RBdS070C16
HP ID HP00015
Gene ID 6188
Gene Symbol RPS3
Protein Name ribosomal protein S3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001005.3
Length of RefSeq (bp) 855
Chromosome 11q13.3-q13.5
Reference DDBJ accession
UniGene Hs.546286
5'-terminal sequence TGCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAGTTT
2011.08.28