ARi19C12 NRCD Human cDNA Clone

Prev. | Human A to Z list > R > RAD54L >

ARi19C12 - NRCD Human cDNA Clone


Catalog Number	HKR167660
Clone Name	ARi19C12
Clone info.	Plasmid clone of human RAD54L cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	GAACGCGCGCTTTGGGAACAGGAAGGTTGAGAGAGAGGTGCTGGGGTCTGCGTCTATCTC
Sequence, submitted⁽³⁾	n.a.
Note	match to NM_003579.4 (4-3076) CDS:full/var
Sequence, refered	NM_003579.4 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	RAD54L (NCBI Gene 8438) other clone of RAD54L in our bank
Synonyms	HR54\|RAD54A\|hHR54\|hRAD54
Protein Name	RAD54 like

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR167660	ARi19C12	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARi19C12 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR167660).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
ARi19C12a.seq		ARi19C12c.seq	ARi19C12z.seq	ARi19C12.pdf