Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAD54L

Gene ID (NCBI) 8438
Gene Symbol RAD54L
Protein Name RAD54 like
Synonyms HR54|RAD54A|hHR54|hRAD54
Databases KEGG hsa:8438 |  NCBI Gene 8438
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10875)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167660 ARi19C12 pGCAP10 NM_003579.3  
GAACGCGCGCTTTGGGAACAGGAAGGTTGAGAGAGAGGTGCTGGGGTCTGCGTCTATCTC
HKR368973 RBd22H05 pGCAP10 NM_003579.3  
GTCTCGTCTCGGCTTATTGGGGACGGCCACTCTCACAGTTTGGTTCCAAACACCAGTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl