Prev. |  KEGG KO K10875 > 

RIKEN DNA Bank Human Resource - RAD54L

Gene ID NCBI Gene 8438 |  KEGG hsa:8438
Gene Symbol RAD54L
Protein Name RAD54 like
Synonyms HR54|RAD54A|hHR54|hRAD54
Ortholog resource in our bank

  RAD54L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167660 ARi19C12 pGCAP10 NM_003579.4 full/var done
GAACGCGCGCTTTGGGAACAGGAAGGTTGAGAGAGAGGTGCTGGGGTCTGCGTCTATCTC
HKR368973 RBd22H05 pGCAP10 NM_003579.4 done
GTCTCGTCTCGGCTTATTGGGGACGGCCACTCTCACAGTTTGGTTCCAAACACCAGTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl