Prev. |  KEGG KO K13696 > 

RIKEN DNA Bank Human Resource - ABHD1

Gene ID NCBI Gene 84696 |  KEGG hsa:84696
Gene Symbol ABHD1
Protein Name abhydrolase domain containing 1
Synonyms LABH1
Ortholog resource in our bank

  ABHD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018487 IRAK046D15 pBluescriptR BC028378 NM_032604 Partial
HGX033856 IRAK084K16 pCMV-SPORT6 BC039576 NM_032604 Full/var
HGX047663 IRAK119C15 pCMV-SPORT6 BC056403 NM_032604 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094817 M01C037A17 pDONR221 MGC08-A09 BC039576 NM_032604  
HGE094865 M01C037C17 pDONR221 MGC08-A09 BC039576 NM_032604  
HGE094913 M01C037E17 pDONR221 MGC08-A09 BC039576 NM_032604  
HGE094961 M01C037G17 pDONR221 MGC08-A09 BC039576 NM_032604  
HGE095009 M01C037I17 pDONR221 MGC08-A09 BC039576 NM_032604  
HGE095057 M01C037K17 pDONR221 MGC08-A09 BC039576 NM_032604  
HGE095105 M01C037M17 pDONR221 MGC08-A09 BC039576 NM_032604  
HGE095153 M01C037O17 pDONR221 MGC08-A09 BC039576 NM_032604  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR192404 ARi81A04 pGCAP10 NM_032604.3  
TTGGGCCTGCAGCGGGGACCGGACCTGCACAGGCCGCCTATGGCGGGCGGCGGGTGGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl