Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASPSCR1

Gene ID (NCBI) 79058
Gene Symbol ASPSCR1
Protein Name alveolar soft part sarcoma chromosome region, candidate 1
Synonyms ASPCR1|ASPL|ASPS|RCC17|TUG|UBXD9|UBXN9
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087289 IRAL018D17 pOTB7 BC006152 NM_024083 Partial/var
HGY096148 IRAL040G04 pOTB7 BC018722 NM_024083 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE081623 M01C004A23 pDONR221 04-134-2_2-E12 BC018722 ENST00000306739
HGE081671 M01C004C23 pDONR221 04-134-2_2-E12 BC018722 ENST00000306739
HGE081719 M01C004E23 pDONR221 04-134-2_2-E12 BC018722 ENST00000306739
HGE081767 M01C004G23 pDONR221 04-134-2_2-E12 BC018722 ENST00000306739
HGE081815 M01C004I23 pDONR221 04-134-2_2-E12 BC018722 ENST00000306739
HGE081863 M01C004K23 pDONR221 04-134-2_2-E12 BC018722 ENST00000306739
HGE081911 M01C004M23 pDONR221 04-134-2_2-E12 BC018722 ENST00000306739
HGE081959 M01C004O23 pDONR221 04-134-2_2-E12 BC018722 ENST00000306739
HGE100824 M01C052A24 pDONR221 MGC15-F12 BC018722 ENST00000306739
HGE100872 M01C052C24 pDONR221 MGC15-F12 BC018722 ENST00000306739
HGE100920 M01C052E24 pDONR221 MGC15-F12 BC018722 ENST00000306739
HGE100968 M01C052G24 pDONR221 MGC15-F12 BC018722 ENST00000306739
HGE101016 M01C052I24 pDONR221 MGC15-F12 BC018722 ENST00000306739
HGE101064 M01C052K24 pDONR221 MGC15-F12 BC018722 ENST00000306739
HGE101112 M01C052M24 pDONR221 MGC15-F12 BC018722 ENST00000306739
HGE101160 M01C052O24 pDONR221 MGC15-F12 BC018722 ENST00000306739
HGE110439 M01C076B15 pDONR221 06-2_01-G08 BC018722 ENST00000306739
HGE110487 M01C076D15 pDONR221 06-2_01-G08 BC018722 ENST00000306739
HGE110535 M01C076F15 pDONR221 06-2_01-G08 BC018722 ENST00000306739
HGE110583 M01C076H15 pDONR221 06-2_01-G08 BC018722 ENST00000306739
HGE110631 M01C076J15 pDONR221 06-2_01-G08 BC018722 ENST00000306739
HGE110679 M01C076L15 pDONR221 06-2_01-G08 BC018722 ENST00000306739
HGE110727 M01C076N15 pDONR221 06-2_01-G08 BC018722 ENST00000306739
HGE110775 M01C076P15 pDONR221 06-2_01-G08 BC018722 ENST00000306739

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE016037 W01A040B13 pENTR-TOPO flj0005i22 AK057403 NM_024083

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR361746 RBd04G02 pGCAP10 NM_024083.2
GGTGAGCGGAAAATGGCGGCCCCGGCAGGCGGCGGAGGCTCCGCGGTGTCGGTGCTGGCC
HKR402828 RBdS007B04 pGCAP10 NM_024083.2
GCTCCTGAGCGGCGGCCCCGCCCCCTGCTCGCCGTCACCTGCGCTTCCGCTGGGGTCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl