Prev. |  KEGG KO K11500 > 

RIKEN DNA Bank Human Resource - CENPH

Gene ID NCBI Gene 64946 |  KEGG hsa:64946
Gene Symbol CENPH
Protein Name centromere protein H
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K11500) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008021 IRAK020A21 pCMV-SPORT6 BC015355 NM_022909 Full
HGX011383 IRAK028H15 pCMV-SPORT6 BC012024 NM_022909 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE092811 M01C032A11 pDONR221 MGC05-E06 BC012024 NM_022909  
HGE092859 M01C032C11 pDONR221 MGC05-E06 BC012024 NM_022909  
HGE092907 M01C032E11 pDONR221 MGC05-E06 BC012024 NM_022909  
HGE092955 M01C032G11 pDONR221 MGC05-E06 BC012024 NM_022909  
HGE093003 M01C032I11 pDONR221 MGC05-E06 BC012024 NM_022909  
HGE093051 M01C032K11 pDONR221 MGC05-E06 BC012024 NM_022909  
HGE093099 M01C032M11 pDONR221 MGC05-E06 BC012024 NM_022909  
HGE093147 M01C032O11 pDONR221 MGC05-E06 BC012024 NM_022909  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050527 ARe26F07 pKA1U5 NM_022909.3  
GCTTTTTTTCTGAGCGCGTTTGCCTGTTGAGTGGTAGCCTTTCCCCTCAACCAGCAATGG
HKR243769 ARiS109H01 pGCAP10 NM_022909.3  
TAAGGATTTTAGTGGCGGGAAAAGCGACCTTTTCTGAGCGCGTTTGCCTGTTGAGTGGTA
HKR327369 RBb18H01 pKA1U5 NM_022909.3  
GCCTTTTCCCGGCGTCCATTTAGTGGCGGGAAANGCTACCTTTTCTGAGCGCGTTTGCCT
HKR380481 RBd51D09 pGCAP10 NM_022909.3  
GATTTAGTGGCGGGAAAAGCGACCTTTTCTGAGCGCGTTTGCCTGTTGAGTGGTAGCCTT
HKR416289 RBdS040M01 pGCAP10 NM_022909.3  
GAGCCTTTCCCCTCAACCAGCAATGGAGGAGCAGCCCCAGATGCAAGACGCCGACGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl